RchiOBHm_Chr4g0408051

AP-1 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
30394695 .. 30394938
244 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGTTGCCAGGCCTAGTTGTGTTAAACATGCTGATGAGGGCCATTACAGTTGATGCTCAAGCTGTACAGAGGCATTGGGCAACTATCTTGGAATGTGTAAAGGTATTCTATCAATGCCCTGTTCTCAATTGTGCTTCATGA

Protein Analysis

46

Amino Acids

5.15

Weight (kDa)

7.75

Isoelectric Point (pI)

32.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 66
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
AoxI GGCC 2 cut(s) 10, 39
AspS9I GGNCC 1 cut(s) 39
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 1 cut(s) 14
Bme1390I CCNGG 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 9
BmsI GCATC 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 9
BshFI GGCC 2 cut(s) 12, 41
BsnI GGCC 2 cut(s) 12, 41
Bsp1407I TGTACA 1 cut(s) 64
BspANI GGCC 2 cut(s) 12, 41
BspHI TCATGA 1 cut(s) 137
BsrGI TGTACA 1 cut(s) 64
Bst2UI CCWGG 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 49
BstAUI TGTACA 1 cut(s) 64
BstNI CCWGG 1 cut(s) 9
BstNSI RCATGY 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 7
BsuRI GGCC 2 cut(s) 12, 41
CciI TCATGA 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 39
Csp6I GTAC 1 cut(s) 65
CviAII CATG 2 cut(s) 28, 138
CviJI RGCY 3 cut(s) 12, 41, 62
CviKI_1 RGCY 3 cut(s) 12, 41, 62
CviQI GTAC 1 cut(s) 65
Eco147I AGGCCT 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 7
FaeI CATG 2 cut(s) 31, 141
FaiI YATR 2 cut(s) 29, 139
FatI CATG 2 cut(s) 27, 137
FspBI CTAG 1 cut(s) 14
HaeIII GGCC 2 cut(s) 12, 41
Hin1II CATG 2 cut(s) 31, 141
Hpy188III TCNNGA 1 cut(s) 138
HpyCH4III ACNGT 1 cut(s) 49
Hsp92II CATG 2 cut(s) 31, 141
LpnPI CCDG 2 cut(s) 21, 132
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 14
MfeI CAATTG 1 cut(s) 127
MluCI AATT 1 cut(s) 127
MnlI CCTC 2 cut(s) 30, 63
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 9
MunI CAATTG 1 cut(s) 127
MvaI CCWGG 1 cut(s) 9
NlaIII CATG 2 cut(s) 31, 141
NspI RCATGY 1 cut(s) 31
PagI TCATGA 1 cut(s) 137
PceI AGGCCT 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
PspPI GGNCC 1 cut(s) 39
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 23
Sau96I GGNCC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 9
SetI ASST 2 cut(s) 64, 105
SfaNI GCATC 1 cut(s) 43
SgeI CNNG 7 cut(s) 20, 21, 26, 40, 71, 100, 131
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 57
SmoI CTYRAG 1 cut(s) 57
Sse9I AATT 1 cut(s) 127
SseBI AGGCCT 1 cut(s) 12
SspMI CTAG 1 cut(s) 14
StuI AGGCCT 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 127
TatI WGTACW 1 cut(s) 64
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TspDTI ATGAA 1 cut(s) 126
XceI RCATGY 1 cut(s) 31
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.