RchiOBHm_Chr4g0408061

AP-1 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
30397603 .. 30398250
648 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 132 bp
ATGTTGGTAAATAATATTGGCATGCTTGATGTAGAGGATCCCATAACGATAACAGAGTCTGATGCTGTGGATATGATAGAAATTGCCCTTAAGCACCATACCTCGGATCTTACTACCAAGATATGGCTTTGA

Protein Analysis

43

Amino Acids

4.84

Weight (kDa)

4.23

Isoelectric Point (pI)

41.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 123
AclWI GGATC 3 cut(s) 32, 45, 114
AfiI CCNNNNNNNGG 2 cut(s) 103, 123
AflII CTTAAG 1 cut(s) 89
AlwI GGATC 3 cut(s) 32, 45, 114
AlwNI CAGNNNCTG 1 cut(s) 59
BamHI GGATCC 1 cut(s) 37
BfrI CTTAAG 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 39
BmsI GCATC 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 123
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 103, 123
BslI CCNNNNNNNGG 2 cut(s) 103, 123
Bsp143I GATC 2 cut(s) 37, 106
BspLI GGNNCC 1 cut(s) 39
BspPI GGATC 3 cut(s) 32, 45, 114
BspTI CTTAAG 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 2 cut(s) 37, 106
BstAFI CTTAAG 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 23
BstKTI GATC 2 cut(s) 40, 109
BstMBI GATC 2 cut(s) 37, 106
BstNSI RCATGY 1 cut(s) 25
BstX2I RGATCY 2 cut(s) 37, 106
BstYI RGATCY 2 cut(s) 37, 106
Cac8I GCNNGC 1 cut(s) 23
CaiI CAGNNNCTG 1 cut(s) 59
CviAII CATG 1 cut(s) 22
CviJI RGCY 1 cut(s) 127
CviKI_1 RGCY 1 cut(s) 127
DpnI GATC 2 cut(s) 39, 108
DpnII GATC 2 cut(s) 37, 106
FaeI CATG 1 cut(s) 25
FaiI YATR 5 cut(s) 23, 44, 74, 99, 124
FatI CATG 1 cut(s) 21
Hin1II CATG 1 cut(s) 25
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 61, 106
Hsp92II CATG 1 cut(s) 25
Kzo9I GATC 2 cut(s) 37, 106
LweI GCATC 1 cut(s) 52
MalI GATC 2 cut(s) 39, 108
MboI GATC 2 cut(s) 37, 106
MflI RGATCY 2 cut(s) 37, 106
MluCI AATT 1 cut(s) 81
MlyI GAGTC 1 cut(s) 65
MnlI CCTC 2 cut(s) 28, 112
MseI TTAA 1 cut(s) 90
MspCI CTTAAG 1 cut(s) 89
NdeII GATC 2 cut(s) 37, 106
NlaIII CATG 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 39
NspI RCATGY 1 cut(s) 25
PaeI GCATGC 1 cut(s) 25
PflMI CCANNNNNTGG 1 cut(s) 123
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 39
PstNI CAGNNNCTG 1 cut(s) 59
PsuI RGATCY 2 cut(s) 37, 106
SaqAI TTAA 1 cut(s) 90
Sau3AI GATC 2 cut(s) 37, 106
SchI GAGTC 1 cut(s) 65
SetI ASST 1 cut(s) 104
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 3 cut(s) 34, 38, 115
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SphI GCATGC 1 cut(s) 25
Sse9I AATT 1 cut(s) 81
SspI AATATT 1 cut(s) 16
TasI AATT 1 cut(s) 81
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
Van91I CCANNNNNTGG 1 cut(s) 123
Vha464I CTTAAG 1 cut(s) 89
XceI RCATGY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.