Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

33631600 .. 33632012

Gene Structure 413 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGCTTCCGTGTATAATGTATTCAGTAAGTAAATGTGTTGACGATGGATTTCCTGCAGTCACCTTTTATTTTGAAAATTCACTTTCTTTGAAGGTTTATCCACATGACTACTTGTTCCCCTCTGTAAGTATTAGGAACTGCAAACATTACTGTCCATTATCCATTCATATTTCTTATGGACCAAATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004175 GO:0004190 GO:0005575 GO:0005623 GO:0005886 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0009056 GO:0009057 GO:0016020 GO:0016787 GO:0019538 GO:0030163 GO:0031224 GO:0031225 GO:0031226 GO:0043170 GO:0044238 GO:0044425 GO:0044459 GO:0044464 GO:0046658 GO:0070001 GO:0070011 GO:0071704 GO:0071944 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TAXi_C TAXi_N

Protein Analysis

62

Amino Acids

7.11

Weight (kDa)

6.79

Isoelectric Point (pI)

47.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	76
AgsI	TTSAA	2 cut(s)	74, 91
ApoI	RAATTY	1 cut(s)	76
AspS9I	GGNCC	1 cut(s)	179
AsuHPI	GGTGA	1 cut(s)	52
AvaII	GGWCC	1 cut(s)	179
BccI	CCATC	1 cut(s)	38
BfmI	CTRYAG	1 cut(s)	54
Bme18I	GGWCC	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	179
BspMAI	CTGCAG	1 cut(s)	58
Bst4CI	ACNGT	1 cut(s)	152
BstSFI	CTRYAG	1 cut(s)	54
Cfr13I	GGNCC	1 cut(s)	179
CviAII	CATG	1 cut(s)	104
Eco47I	GGWCC	1 cut(s)	179
FaeI	CATG	1 cut(s)	107
FaiI	YATR	4 cut(s)	14, 105, 168, 177
FatI	CATG	1 cut(s)	103
Hin1II	CATG	1 cut(s)	107
HincII	GTYRAC	1 cut(s)	40
HindII	GTYRAC	1 cut(s)	40
HphI	GGTGA	1 cut(s)	52
Hpy166II	GTNNAC	1 cut(s)	40
Hpy8I	GTNNAC	1 cut(s)	40
HpyAV	CCTTC	1 cut(s)	85
HpyCH4III	ACNGT	1 cut(s)	152
HpyCH4V	TGCA	2 cut(s)	56, 141
Hsp92II	CATG	1 cut(s)	107
LpnPI	CCDG	1 cut(s)	66
MaeIII	GTNAC	1 cut(s)	58
MluCI	AATT	2 cut(s)	76, 184
MnlI	CCTC	1 cut(s)	130
NlaIII	CATG	1 cut(s)	107
NmuCI	GTSAC	1 cut(s)	58
PspPI	GGNCC	1 cut(s)	179
PstI	CTGCAG	1 cut(s)	58
Sau96I	GGNCC	1 cut(s)	179
SetI	ASST	2 cut(s)	65, 96
SfcI	CTRYAG	1 cut(s)	54
SgeI	CNNG	4 cut(s)	21, 65, 116, 124
SinI	GGWCC	1 cut(s)	179
Sse9I	AATT	2 cut(s)	76, 184
TaaI	ACNGT	1 cut(s)	152
TasI	AATT	2 cut(s)	76, 184
TseFI	GTSAC	1 cut(s)	58
Tsp45I	GTSAC	1 cut(s)	58
TspDTI	ATGAA	1 cut(s)	155
VpaK11BI	GGWCC	1 cut(s)	179
XapI	RAATTY	1 cut(s)	76

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.