RchiOBHm_Chr4g0410861

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
34629225 .. 34630936
1712 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGATTGAATGTCTAAGGAAGCAGCTTTTCCAGCGTCCATCACATATTCAGGCCATGGCATTTGCTCCAGTTGTTGCTGGAAAAACCTCTATTAACAAAGTGGATCTGGCAAAACATTGGCTTATCTTGCTCCTGTCATTCAGCGTTTAA

Protein Analysis

49

Amino Acids

5.55

Weight (kDa)

10.03

Isoelectric Point (pI)

71.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 111
AgsI TTSAA 1 cut(s) 8
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
AlwI GGATC 1 cut(s) 111
AoxI GGCC 1 cut(s) 51
ApeKI GCWGC 1 cut(s) 22
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 46
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
BpmI CTGGAG 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 68
BseXI GCAGC 1 cut(s) 34
BshFI GGCC 1 cut(s) 53
BsnI GGCC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 103
Bsp19I CCATGG 1 cut(s) 54
BspANI GGCC 1 cut(s) 53
BspPI GGATC 1 cut(s) 111
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 14
BstDSI CCRYGG 1 cut(s) 54
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 31, 127
BstV1I GCAGC 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 103
BstYI RGATCY 1 cut(s) 103
BsuRI GGCC 1 cut(s) 53
BtgI CCRYGG 1 cut(s) 54
CseI GACGC 1 cut(s) 23
CviAII CATG 1 cut(s) 55
CviJI RGCY 3 cut(s) 25, 53, 121
CviKI_1 RGCY 3 cut(s) 25, 53, 121
DdeI CTNAG 1 cut(s) 14
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eco130I CCWWGG 1 cut(s) 54
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 45, 56
FatI CATG 1 cut(s) 54
Fnu4HI GCNGC 1 cut(s) 23
Fsp4HI GCNGC 1 cut(s) 23
GluI GCNGC 1 cut(s) 23
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 53
HgaI GACGC 1 cut(s) 23
Hin1II CATG 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 127
HpyF3I CTNAG 1 cut(s) 14
Hsp92II CATG 1 cut(s) 58
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 2 cut(s) 70, 135
LpnPI CCDG 6 cut(s) 35, 44, 63, 81, 92, 146
Lsp1109I GCAGC 1 cut(s) 34
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MflI RGATCY 1 cut(s) 103
MnlI CCTC 1 cut(s) 97
MseI TTAA 2 cut(s) 93, 148
MwoI GCNNNNNNNGC 2 cut(s) 31, 127
NcoI CCATGG 1 cut(s) 54
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 58
PkrI GCNGC 1 cut(s) 24
PsuI RGATCY 1 cut(s) 103
SaqAI TTAA 2 cut(s) 93, 148
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 103
SetI ASST 2 cut(s) 27, 89
SgeI CNNG 8 cut(s) 43, 62, 67, 80, 90, 119, 139, 145
StyI CCWWGG 1 cut(s) 54
Tru1I TTAA 2 cut(s) 93, 148
Tru9I TTAA 2 cut(s) 93, 148
TseI GCWGC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.