RchiOBHm_Chr4g0413951
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
38300227 .. 38303366
3140 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGACAGAGACCGTGTTGTTGAGGTTTGATGAGCTGCGAGAAGCTATGTTGCTTGTTTTTGCCAACAAGCAAGATCTTCCCAATGCAATGAATGCTGCTGAAATTACTGATAAGCTAATTAGCCTCCACTCTCTCCGACAACGTCACTGGTACATCCAGAACACTTGTGCAACCACTGGAGAGGGTCTATTTGAAGGTCTGGATTGGCTCTCCAATAACATTGCTACCAAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.89

Weight (kDa)

5.16

Isoelectric Point (pI)

40.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 5 - 74 3.1e-21 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029867)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0173361 RchiOBHm_Chr4g0413951

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 152
AgsI TTSAA 1 cut(s) 194
AluBI AGCT 3 cut(s) 34, 44, 115
AluI AGCT 3 cut(s) 34, 44, 115
Alw26I GTCTC 1 cut(s) 2
ApeKI GCWGC 2 cut(s) 34, 95
BbvI GCAGC 2 cut(s) 21, 82
BcoDI GTCTC 1 cut(s) 2
BglII AGATCT 1 cut(s) 73
BisI GCNGC 2 cut(s) 35, 96
BlsI GCNGC 2 cut(s) 36, 97
BpmI CTGGAG 1 cut(s) 198
BsaI GGTCTC 1 cut(s) 2
BsaJI CCNNGG 1 cut(s) 228
Bse1I ACTGG 2 cut(s) 152, 181
Bse3DI GCAATG 2 cut(s) 93, 219
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 153
BseMI GCAATG 2 cut(s) 93, 219
BseNI ACTGG 2 cut(s) 152, 181
BseXI GCAGC 2 cut(s) 21, 82
BsmAI GTCTC 1 cut(s) 2
BsmI GAATGC 1 cut(s) 97
Bso31I GGTCTC 1 cut(s) 2
Bsp143I GATC 1 cut(s) 73
BspTNI GGTCTC 1 cut(s) 2
BsrDI GCAATG 2 cut(s) 93, 219
BsrI ACTGG 2 cut(s) 152, 181
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 228
Bst4CI ACNGT 1 cut(s) 13
BstAPI GCANNNNNTGC 1 cut(s) 92
BstF5I GGATG 1 cut(s) 153
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 1 cut(s) 2
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 2 cut(s) 92, 230
BstV1I GCAGC 2 cut(s) 21, 82
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BtsCI GGATG 1 cut(s) 153
BtsIMutI CAGTG 2 cut(s) 145, 174
Csp6I GTAC 1 cut(s) 151
CviJI RGCY 6 cut(s) 34, 44, 115, 123, 208, 233
CviKI_1 RGCY 6 cut(s) 34, 44, 115, 123, 208, 233
CviQI GTAC 1 cut(s) 151
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 2
EcoT14I CCWWGG 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 228
FaiI YATR 1 cut(s) 47
Fnu4HI GCNGC 2 cut(s) 35, 96
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 2 cut(s) 35, 96
GluI GCNGC 2 cut(s) 35, 96
GsuI CTGGAG 1 cut(s) 198
Hpy188I TCNGA 1 cut(s) 137
Hpy188III TCNNGA 2 cut(s) 157, 200
HpyAV CCTTC 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 2 cut(s) 86, 170
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 230
HpySE526I ACGT 1 cut(s) 142
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 4 cut(s) 133, 162, 170, 185
Lsp1109I GCAGC 2 cut(s) 21, 82
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 143
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 1 cut(s) 68
MflI RGATCY 1 cut(s) 73
MluCI AATT 2 cut(s) 102, 117
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 3 cut(s) 15, 134, 175
Mva1269I GAATGC 1 cut(s) 97
MwoI GCNNNNNNNGC 2 cut(s) 92, 230
NdeII GATC 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 143
PctI GAATGC 1 cut(s) 97
PflFI GACNNNGTC 1 cut(s) 141
PkrI GCNGC 2 cut(s) 36, 97
PsuI RGATCY 1 cut(s) 73
PsyI GACNNNGTC 1 cut(s) 141
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SatI GCNGC 2 cut(s) 35, 96
Sau3AI GATC 1 cut(s) 73
SetI ASST 6 cut(s) 26, 36, 46, 117, 145, 199
Sse9I AATT 2 cut(s) 102, 117
StyI CCWWGG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 145
TasI AATT 2 cut(s) 102, 117
TscAI CASTG 2 cut(s) 152, 181
TseFI GTSAC 1 cut(s) 143
TseI GCWGC 2 cut(s) 34, 95
Tsp45I GTSAC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 104
TspRI CASTG 2 cut(s) 152, 181
Tth111I GACNNNGTC 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.