RchiOBHm_Chr4g0414941

disulfide-isomerase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
39448261 .. 39450444
2184 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 384 bp
ATGTTGTTTCTGAACTTCAGCAGTGATGTTGCTGATGCTTTTAAATCAAAGTATCGTGAAGTAGCTGAGAAATACAAAGGAGAGGGCATAAGCTTTTTAGTTGGAGATCTAGAGGCTAGTCAAGGTGCCTTCCAGTACTTTGGACTTAAAGAAGAGCAAGTGCCTCTCATCATCATACAGACCAATGACGGACAAAAGTTTTTGAAACCACATTTGGAGCCAGATCATATTTCAGTTTGGGTGAAGGAATACAAGGATGGGAAAGTATCACCATACAAGAAGTCTGAACCCATCCCTGAGAAGAACGATGACCCTGTTAAAGTTGTAGTCGCTGAGAGCCTCCAGGACATTGTTTTCAAGTCTGGGAAAAATGTGATGCTCTAG

Protein Analysis

127

Amino Acids

14.37

Weight (kDa)

5.42

Isoelectric Point (pI)

20.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thioredoxin_6 PF13848 1 - 82 4.1e-09 Thioredoxin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 125
AfaI GTAC 1 cut(s) 137
AgsI TTSAA 2 cut(s) 205, 358
AjnI CCWGG 1 cut(s) 342
AjuI GAANNNNNNNTTGG 2 cut(s) 197, 229
AluBI AGCT 2 cut(s) 65, 93
AluI AGCT 2 cut(s) 65, 93
AsuHPI GGTGA 2 cut(s) 253, 261
BanI GGYRCC 1 cut(s) 125
BccI CCATC 2 cut(s) 251, 299
BciT130I CCWGG 1 cut(s) 344
BfaI CTAG 3 cut(s) 110, 117, 382
BglII AGATCT 1 cut(s) 106
BmcAI AGTACT 1 cut(s) 137
Bme1390I CCNGG 1 cut(s) 344
BmiI GGNNCC 2 cut(s) 127, 219
BmrFI CCNGG 1 cut(s) 344
BmsI GCATC 2 cut(s) 25, 366
BpmI CTGGAG 1 cut(s) 326
Bse1I ACTGG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 344
BseGI GGATG 2 cut(s) 262, 291
BseMII CTCAG 3 cut(s) 57, 288, 324
BseNI ACTGG 1 cut(s) 133
BshNI GGYRCC 1 cut(s) 125
Bsp143I GATC 2 cut(s) 106, 223
BspCNI CTCAG 3 cut(s) 58, 289, 325
BspLI GGNNCC 2 cut(s) 127, 219
BspQI GCTCTTC 1 cut(s) 147
BspT107I GGYRCC 1 cut(s) 125
BsrI ACTGG 1 cut(s) 133
BssMI GATC 2 cut(s) 106, 223
Bst2UI CCWGG 1 cut(s) 344
Bst6I CTCTTC 1 cut(s) 147
BstDEI CTNAG 3 cut(s) 66, 297, 333
BstF5I GGATG 2 cut(s) 262, 291
BstKTI GATC 2 cut(s) 109, 226
BstMBI GATC 2 cut(s) 106, 223
BstNI CCWGG 1 cut(s) 344
BstSCI CCNGG 1 cut(s) 342
BstX2I RGATCY 1 cut(s) 106
BstXI CCANNNNNNTGG 1 cut(s) 140
BstYI RGATCY 1 cut(s) 106
BtsCI GGATG 2 cut(s) 262, 291
BtsI GCAGTG 1 cut(s) 28
BtsIMutI CAGTG 1 cut(s) 28
Csp6I GTAC 1 cut(s) 136
CviJI RGCY 5 cut(s) 65, 93, 116, 220, 339
CviKI_1 RGCY 5 cut(s) 65, 93, 116, 220, 339
CviQI GTAC 1 cut(s) 136
DdeI CTNAG 3 cut(s) 66, 297, 333
DpnI GATC 2 cut(s) 108, 225
DpnII GATC 2 cut(s) 106, 223
DraI TTTAAA 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 342
FaiI YATR 4 cut(s) 89, 176, 228, 274
FokI GGATG 2 cut(s) 269, 278
FspBI CTAG 3 cut(s) 110, 117, 382
GsuI CTGGAG 1 cut(s) 326
HindIII AAGCTT 1 cut(s) 91
HphI GGTGA 2 cut(s) 253, 261
Hpy188I TCNGA 2 cut(s) 12, 286
Hpy188III TCNNGA 2 cut(s) 56, 110
HpyAV CCTTC 2 cut(s) 139, 238
HpyF3I CTNAG 3 cut(s) 66, 297, 333
Kzo9I GATC 2 cut(s) 106, 223
LguI GCTCTTC 1 cut(s) 147
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 7 cut(s) 146, 234, 309, 327, 329, 348, 356
LweI GCATC 2 cut(s) 25, 366
MaeI CTAG 3 cut(s) 110, 117, 382
MalI GATC 2 cut(s) 108, 225
MboI GATC 2 cut(s) 106, 223
MboII GAAGA 2 cut(s) 164, 313
MflI RGATCY 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 4 cut(s) 76, 106, 174, 350
MseI TTAA 3 cut(s) 42, 147, 318
MspR9I CCNGG 1 cut(s) 344
MvaI CCWGG 1 cut(s) 344
NdeII GATC 2 cut(s) 106, 223
NlaIV GGNNCC 2 cut(s) 127, 219
PciSI GCTCTTC 1 cut(s) 147
PfoI TCCNGGA 1 cut(s) 342
Psp6I CCWGG 1 cut(s) 342
PspGI CCWGG 1 cut(s) 342
PspN4I GGNNCC 2 cut(s) 127, 219
PsuI RGATCY 1 cut(s) 106
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SapI GCTCTTC 1 cut(s) 147
SaqAI TTAA 3 cut(s) 42, 147, 318
Sau3AI GATC 2 cut(s) 106, 223
ScaI AGTACT 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 344
SetI ASST 3 cut(s) 67, 95, 127
SfaNI GCATC 2 cut(s) 25, 366
SspMI CTAG 3 cut(s) 110, 117, 382
StyD4I CCNGG 1 cut(s) 342
TatI WGTACW 1 cut(s) 135
Tru1I TTAA 3 cut(s) 42, 147, 318
Tru9I TTAA 3 cut(s) 42, 147, 318
TscAI CASTG 1 cut(s) 28
TspGWI ACGGA 1 cut(s) 204
TspRI CASTG 1 cut(s) 28
XbaI TCTAGA 1 cut(s) 109
XspI CTAG 3 cut(s) 110, 117, 382
ZrmI AGTACT 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.