RchiOBHm_Chr4g0417801

Transcription initiation factor TFIID subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
43092738 .. 43097041
4304 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGGCAAAAAGTATGAGCAAAAGGATGATGGACTTCCTGTTGAGCTTAAATTACCGGTTAAGCATGTATTGTCTAGAGAGCTTCAGCTATATTTTGACAAAAATCACTGAGCTTGTCGTGAGTAGGTCCGATGTTATTCTTCTTAAAAAAGCACTATTGAGCTTGGCGACTGATTCGGGACTTCATCCATTAGTTCCTTATTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.65

Weight (kDa)

9.25

Isoelectric Point (pI)

49.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 67
AgeI ACCGGT 1 cut(s) 54
AluBI AGCT 5 cut(s) 45, 81, 87, 112, 162
AluI AGCT 5 cut(s) 45, 81, 87, 112, 162
AsiGI ACCGGT 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 126
AvaII GGWCC 1 cut(s) 126
BccI CCATC 1 cut(s) 22
BfaI CTAG 1 cut(s) 74
Bme18I GGWCC 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 126
BsaWI WCCGGW 1 cut(s) 54
Bse118I RCCGGY 1 cut(s) 54
BseGI GGATG 2 cut(s) 30, 184
BseMII CTCAG 1 cut(s) 99
BshTI ACCGGT 1 cut(s) 54
BsiSI CCGG 1 cut(s) 55
BslFI GGGAC 1 cut(s) 192
BsmFI GGGAC 1 cut(s) 192
BspCNI CTCAG 1 cut(s) 100
BsrFI RCCGGY 1 cut(s) 54
BssAI RCCGGY 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 2 cut(s) 30, 184
BstNSI RCATGY 1 cut(s) 67
BtsCI GGATG 2 cut(s) 30, 184
BtsIMutI CAGTG 1 cut(s) 105
Cfr10I RCCGGY 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 126
CspAI ACCGGT 1 cut(s) 54
CviAII CATG 1 cut(s) 64
CviJI RGCY 5 cut(s) 45, 81, 87, 112, 162
CviKI_1 RGCY 5 cut(s) 45, 81, 87, 112, 162
DdeI CTNAG 1 cut(s) 108
Eco47I GGWCC 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 67
FaeI CATG 1 cut(s) 67
FaiI YATR 3 cut(s) 14, 65, 90
FaqI GGGAC 1 cut(s) 192
FatI CATG 1 cut(s) 63
FokI GGATG 2 cut(s) 37, 171
FspBI CTAG 1 cut(s) 74
HapII CCGG 1 cut(s) 55
Hin1II CATG 1 cut(s) 67
HinfI GANTC 1 cut(s) 173
HpaII CCGG 1 cut(s) 55
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 3 cut(s) 74, 118, 177
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 1 cut(s) 67
LpnPI CCDG 2 cut(s) 50, 68
MaeI CTAG 1 cut(s) 74
MboII GAAGA 1 cut(s) 131
MluCI AATT 1 cut(s) 49
MseI TTAA 4 cut(s) 47, 59, 144, 202
MspI CCGG 1 cut(s) 55
NlaIII CATG 1 cut(s) 67
NspI RCATGY 1 cut(s) 67
PfeI GAWTC 1 cut(s) 173
PinAI ACCGGT 1 cut(s) 54
PspPI GGNCC 1 cut(s) 126
SaqAI TTAA 4 cut(s) 47, 59, 144, 202
Sau96I GGNCC 1 cut(s) 126
SetI ASST 6 cut(s) 47, 83, 89, 114, 128, 164
SgeI CNNG 8 cut(s) 49, 67, 76, 86, 125, 130, 175, 189
SinI GGWCC 1 cut(s) 126
Sse9I AATT 1 cut(s) 49
SspMI CTAG 1 cut(s) 74
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 4 cut(s) 47, 59, 144, 202
Tru9I TTAA 4 cut(s) 47, 59, 144, 202
TscAI CASTG 1 cut(s) 112
TspDTI ATGAA 1 cut(s) 173
TspRI CASTG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 126
XbaI TCTAGA 1 cut(s) 73
XceI RCATGY 1 cut(s) 67
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.