RchiOBHm_Chr4g0419361

squalene

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
44798636 .. 44799500
865 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
ATGCTCCAGCAGAAACTTCACCGTCGGAGCAGATCGAAAATTGATTTCTCCAGATGCTCCAGCAGAAACTTCACCATCGGAGCAGATCCAAAATCGATAGCCATATTTGTTGTAGTGTTGTTTCTCCATTTCTTTGCTATTGCTATATATGGTGTCGGCCGCTTAATGCTTCCGTTCCCTTCACCTAAACGCATGTGGCTCGGGTTTCGATTGATCTTGAGTGCATCAGGCATCATATTCCCCATTATAAAGGGTGAAGGAGTTAGACAGATGTTCTTTCCTGCCACAGTACCAGCATATTACAGATCGCTTCCTGTTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.23

Weight (kDa)

11.47

Isoelectric Point (pI)

61.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 248
AciI CCGC 1 cut(s) 160
AclWI GGATC 1 cut(s) 80
AcoI YGGCCR 1 cut(s) 157
AfaI GTAC 1 cut(s) 291
AlwI GGATC 1 cut(s) 80
Ama87I CYCGRG 1 cut(s) 200
AoxI GGCC 1 cut(s) 157
AsuHPI GGTGA 4 cut(s) 11, 64, 174, 266
AvaI CYCGRG 1 cut(s) 200
BccI CCATC 1 cut(s) 83
BcgI CGANNNNNNTGC 2 cut(s) 181, 215
BisI GCNGC 1 cut(s) 160
BlsI GCNGC 1 cut(s) 161
BmeT110I CYCGRG 1 cut(s) 200
BmsI GCATC 3 cut(s) 44, 233, 240
BpmI CTGGAG 2 cut(s) 34, 43
BpuEI CTTGAG 1 cut(s) 238
Bsa29I ATCGAT 1 cut(s) 95
BseCI ATCGAT 1 cut(s) 95
BseX3I CGGCCG 1 cut(s) 157
Bsh1285I CGRYCG 1 cut(s) 160
BshFI GGCC 1 cut(s) 159
BshVI ATCGAT 1 cut(s) 95
BsiEI CGRYCG 1 cut(s) 160
BsiHKCI CYCGRG 1 cut(s) 200
BsnI GGCC 1 cut(s) 159
BsoBI CYCGRG 1 cut(s) 200
Bsp143I GATC 4 cut(s) 32, 85, 213, 305
BspACI CCGC 1 cut(s) 160
BspANI GGCC 1 cut(s) 159
BspDI ATCGAT 1 cut(s) 95
BspPI GGATC 1 cut(s) 80
BssMI GATC 4 cut(s) 32, 85, 213, 305
Bst4CI ACNGT 2 cut(s) 23, 289
BstKTI GATC 4 cut(s) 35, 88, 216, 308
BstMBI GATC 4 cut(s) 32, 85, 213, 305
BstMCI CGRYCG 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 196
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BstZI CGGCCG 1 cut(s) 157
Bsu15I ATCGAT 1 cut(s) 95
BsuRI GGCC 1 cut(s) 159
BsuTUI ATCGAT 1 cut(s) 95
ClaI ATCGAT 1 cut(s) 95
Csp6I GTAC 1 cut(s) 290
CviAII CATG 1 cut(s) 193
CviJI RGCY 3 cut(s) 101, 159, 199
CviKI_1 RGCY 3 cut(s) 101, 159, 199
CviQI GTAC 1 cut(s) 290
DpnI GATC 4 cut(s) 34, 87, 215, 307
DpnII GATC 4 cut(s) 32, 85, 213, 305
EaeI YGGCCR 1 cut(s) 157
EagI CGGCCG 1 cut(s) 157
EclXI CGGCCG 1 cut(s) 157
Eco52I CGGCCG 1 cut(s) 157
Eco88I CYCGRG 1 cut(s) 200
FaeI CATG 1 cut(s) 196
FaiI YATR 8 cut(s) 104, 146, 148, 150, 194, 236, 248, 298
FatI CATG 1 cut(s) 192
Fnu4HI GCNGC 1 cut(s) 160
Fsp4HI GCNGC 1 cut(s) 160
GluI GCNGC 1 cut(s) 160
GsuI CTGGAG 2 cut(s) 34, 43
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 1 cut(s) 196
HphI GGTGA 4 cut(s) 11, 64, 174, 266
Hpy188I TCNGA 2 cut(s) 27, 80
Hpy188III TCNNGA 2 cut(s) 51, 217
Hpy99I CGWCG 1 cut(s) 27
HpyAV CCTTC 2 cut(s) 189, 251
HpyCH4III ACNGT 2 cut(s) 23, 289
HpyCH4V TGCA 1 cut(s) 224
Hsp92II CATG 1 cut(s) 196
Kzo9I GATC 4 cut(s) 32, 85, 213, 305
LmnI GCTCC 4 cut(s) 9, 27, 62, 80
LpnPI CCDG 6 cut(s) 20, 64, 73, 213, 294, 306
LweI GCATC 3 cut(s) 44, 233, 240
MalI GATC 4 cut(s) 34, 87, 215, 307
MboI GATC 4 cut(s) 32, 85, 213, 305
MflI RGATCY 1 cut(s) 85
MluCI AATT 1 cut(s) 39
MmeI TCCRAC 1 cut(s) 5
MseI TTAA 1 cut(s) 164
NdeII GATC 4 cut(s) 32, 85, 213, 305
NlaIII CATG 1 cut(s) 196
NspI RCATGY 1 cut(s) 196
PkrI GCNGC 1 cut(s) 161
PsiI TTATAA 1 cut(s) 248
PsuI RGATCY 1 cut(s) 85
RsaI GTAC 1 cut(s) 291
RsaNI GTAC 1 cut(s) 290
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 1 cut(s) 160
Sau3AI GATC 4 cut(s) 32, 85, 213, 305
SetI ASST 1 cut(s) 187
SfaNI GCATC 3 cut(s) 44, 233, 240
SmlI CTYRAG 1 cut(s) 217
SmoI CTYRAG 1 cut(s) 217
Sse9I AATT 1 cut(s) 39
SsiI CCGC 1 cut(s) 160
TaaI ACNGT 2 cut(s) 23, 289
TaqI TCGA 3 cut(s) 35, 95, 208
TasI AATT 1 cut(s) 39
TauI GCSGC 1 cut(s) 162
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 308
TspGWI ACGGA 1 cut(s) 162
XceI RCATGY 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.