RchiOBHm_Chr4g0421161

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
46829032 .. 46831061
2030 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGAAGGGGCTTATCATGGACAATATTATTATAGCCTTTGAGTTCATATATGCACTCAAGAAAAGAAGGAGGAATGTGAGAAAGAAAATGATTCTAGAGATTGAGATGGCCAAAGGATACAATGCTGTGGAGTGGGGTAATGCTTTCCTACTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

52

Amino Acids

6.17

Weight (kDa)

9.99

Isoelectric Point (pI)

64.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 108
AoxI GGCC 1 cut(s) 108
BalI TGGCCA 1 cut(s) 110
BccI CCATC 1 cut(s) 100
BciVI GTATCC 1 cut(s) 110
BfaI CTAG 1 cut(s) 95
BfuI GTATCC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 41
BshFI GGCC 1 cut(s) 110
BsnI GGCC 1 cut(s) 110
BspANI GGCC 1 cut(s) 110
BsuI GTATCC 1 cut(s) 110
BsuRI GGCC 1 cut(s) 110
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 10, 35, 110
CviKI_1 RGCY 3 cut(s) 10, 35, 110
EaeI YGGCCR 1 cut(s) 108
FaeI CATG 1 cut(s) 19
FaiI YATR 5 cut(s) 17, 32, 47, 49, 51
FatI CATG 1 cut(s) 15
FspBI CTAG 1 cut(s) 95
HaeIII GGCC 1 cut(s) 110
Hin1II CATG 1 cut(s) 19
HinfI GANTC 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 58, 95
HpyAV CCTTC 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 53
Hsp92II CATG 1 cut(s) 19
MaeI CTAG 1 cut(s) 95
MlsI TGGCCA 1 cut(s) 110
MluNI TGGCCA 1 cut(s) 110
MnlI CCTC 1 cut(s) 63
Mox20I TGGCCA 1 cut(s) 110
MscI TGGCCA 1 cut(s) 110
Msp20I TGGCCA 1 cut(s) 110
NlaIII CATG 1 cut(s) 19
PfeI GAWTC 1 cut(s) 91
SgeI CNNG 3 cut(s) 28, 70, 107
SmlI CTYRAG 1 cut(s) 56
SmoI CTYRAG 1 cut(s) 56
SspI AATATT 1 cut(s) 25
SspMI CTAG 1 cut(s) 95
TfiI GAWTC 1 cut(s) 91
TspDTI ATGAA 2 cut(s) 17, 34
XbaI TCTAGA 1 cut(s) 94
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.