RchiOBHm_Chr4g0424401

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
50022100 .. 50023519
1420 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGAATGCAGAGTTCTGTATAGTTTTGATCGGCATGTATGCGAAATGTGGGTTTTTGAATGGAGCAGAACAAGTTTTTGAGCTGTTGCAAGAGAAGAATGTAATGGCATGGACTGCATTGTCTGTGGATCAGCACAACATGGCTCCAGCAAAGAAGCTTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.02

Weight (kDa)

5.57

Isoelectric Point (pI)

33.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 118
AclWI GGATC 1 cut(s) 135
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 2 cut(s) 82, 157
AluI AGCT 2 cut(s) 82, 157
AlwI GGATC 1 cut(s) 135
BmiI GGNNCC 1 cut(s) 144
BpmI CTGGAG 1 cut(s) 129
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 2 cut(s) 27, 127
BspLI GGNNCC 1 cut(s) 144
BspPI GGATC 1 cut(s) 135
BssMI GATC 2 cut(s) 27, 127
BstAPI GCANNNNNTGC 1 cut(s) 113
BstKTI GATC 2 cut(s) 30, 130
BstMBI GATC 2 cut(s) 27, 127
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 37
CviAII CATG 3 cut(s) 34, 108, 139
CviJI RGCY 3 cut(s) 82, 143, 157
CviKI_1 RGCY 3 cut(s) 82, 143, 157
DpnI GATC 2 cut(s) 29, 129
DpnII GATC 2 cut(s) 27, 127
DrdI GACNNNNNNGTC 1 cut(s) 118
DseDI GACNNNNNNGTC 1 cut(s) 118
FaeI CATG 3 cut(s) 37, 111, 142
FaiI YATR 5 cut(s) 20, 35, 39, 109, 140
FatI CATG 3 cut(s) 33, 107, 138
FspEI CC 9 cut(s) 15, 33, 34, 45, 89, 94, 110, 125, 159
GsuI CTGGAG 1 cut(s) 129
Hin1II CATG 3 cut(s) 37, 111, 142
HindIII AAGCTT 1 cut(s) 155
HpyCH4V TGCA 3 cut(s) 8, 88, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
Hsp92II CATG 3 cut(s) 37, 111, 142
Kzo9I GATC 2 cut(s) 27, 127
LmnI GCTCC 2 cut(s) 62, 148
LpnPI CCDG 1 cut(s) 159
MalI GATC 2 cut(s) 29, 129
MboI GATC 2 cut(s) 27, 127
MboII GAAGA 1 cut(s) 106
Mva1269I GAATGC 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 2 cut(s) 27, 127
NlaIII CATG 3 cut(s) 37, 111, 142
NlaIV GGNNCC 1 cut(s) 144
NspI RCATGY 1 cut(s) 37
PctI GAATGC 1 cut(s) 10
PspN4I GGNNCC 1 cut(s) 144
Sau3AI GATC 2 cut(s) 27, 127
SetI ASST 3 cut(s) 84, 159, 164
SgeI CNNG 6 cut(s) 46, 83, 101, 120, 151, 158
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.