RchiOBHm_Chr4g0430491

Flavonoid 3',5'-methyltransferase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
55016420 .. 55016951
532 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGGCTGCTAATCATGATCATGAGAAAGATTTAGACAAGATCATCCTCAAAAGCCCAGCACTTCTCAAGTACATCCTAGAAATAAGCTGCTATCCCAGAGAACACGAGCAATTGAAGCAACTATCGAGAAATACCAGTTCTGTCTTATGA

Protein Analysis

49

Amino Acids

5.69

Weight (kDa)

6.81

Isoelectric Point (pI)

51.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 71
AgsI TTSAA 1 cut(s) 115
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
ApeKI GCWGC 2 cut(s) 5, 87
BauI CACGAG 1 cut(s) 104
BbvI GCAGC 1 cut(s) 74
BclI TGATCA 1 cut(s) 16
BfaI CTAG 1 cut(s) 77
BisI GCNGC 2 cut(s) 6, 88
BlsI GCNGC 2 cut(s) 7, 89
BpuEI CTTGAG 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 42, 72
BseNI ACTGG 1 cut(s) 135
BseXI GCAGC 1 cut(s) 74
BseYI CCCAGC 1 cut(s) 55
Bsp143I GATC 2 cut(s) 16, 39
BspHI TCATGA 2 cut(s) 13, 19
BsrI ACTGG 1 cut(s) 135
BssMI GATC 2 cut(s) 16, 39
BssSI CACGAG 1 cut(s) 104
Bst2BI CACGAG 1 cut(s) 104
BstF5I GGATG 2 cut(s) 42, 72
BstKTI GATC 2 cut(s) 19, 42
BstMBI GATC 2 cut(s) 16, 39
BstMWI GCNNNNNNNGC 1 cut(s) 115
BstV1I GCAGC 1 cut(s) 74
BtsCI GGATG 2 cut(s) 42, 72
CciI TCATGA 2 cut(s) 13, 19
Csp6I GTAC 1 cut(s) 70
CviAII CATG 2 cut(s) 14, 20
CviJI RGCY 3 cut(s) 5, 54, 87
CviKI_1 RGCY 3 cut(s) 5, 54, 87
CviQI GTAC 1 cut(s) 70
DpnI GATC 2 cut(s) 18, 41
DpnII GATC 2 cut(s) 16, 39
FaeI CATG 2 cut(s) 17, 23
FaiI YATR 3 cut(s) 15, 21, 148
FatI CATG 2 cut(s) 13, 19
FbaI TGATCA 1 cut(s) 16
Fnu4HI GCNGC 2 cut(s) 6, 88
FokI GGATG 2 cut(s) 29, 59
Fsp4HI GCNGC 2 cut(s) 6, 88
FspBI CTAG 1 cut(s) 77
FspEI CC 6 cut(s) 59, 68, 69, 89, 108, 109
GluI GCNGC 2 cut(s) 6, 88
GsaI CCCAGC 1 cut(s) 59
Hin1II CATG 2 cut(s) 17, 23
Hpy188III TCNNGA 3 cut(s) 14, 20, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 115
Hsp92II CATG 2 cut(s) 17, 23
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 2 cut(s) 16, 39
LpnPI CCDG 2 cut(s) 69, 109
Lsp1109I GCAGC 1 cut(s) 74
MaeI CTAG 1 cut(s) 77
MalI GATC 2 cut(s) 18, 41
MboI GATC 2 cut(s) 16, 39
MfeI CAATTG 1 cut(s) 110
MluCI AATT 1 cut(s) 110
MnlI CCTC 1 cut(s) 56
MslI CAYNNNNRTG 1 cut(s) 18
MunI CAATTG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 115
NdeII GATC 2 cut(s) 16, 39
NlaIII CATG 2 cut(s) 17, 23
PagI TCATGA 2 cut(s) 13, 19
PkrI GCNGC 2 cut(s) 7, 89
PspFI CCCAGC 1 cut(s) 55
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
RseI CAYNNNNRTG 1 cut(s) 18
SatI GCNGC 2 cut(s) 6, 88
Sau3AI GATC 2 cut(s) 16, 39
SetI ASST 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 1 cut(s) 110
SspMI CTAG 1 cut(s) 77
TaqI TCGA 1 cut(s) 125
TasI AATT 1 cut(s) 110
TatI WGTACW 1 cut(s) 69
TseI GCWGC 2 cut(s) 5, 87
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.