RchiOBHm_Chr4g0432191

Lactoylglutathione lyase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
56378360 .. 56380667
2308 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCACCTTATTGAGAGGAACCAAACTTACCAGCTTCCTGAAGGACCCTGCAACACCACGTCACCGGTAGCCGACCCGAGCCACCTTCCCAAAGGCCACCATATCTACTTCTTTGTCTCCAATTTCGAATCTTTTGTGCAAACGCTCGAGGAGAAGGGAATCCAGTCTTTTCAGGTCATTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.98

Weight (kDa)

5.65

Isoelectric Point (pI)

60.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 60
AgeI ACCGGT 1 cut(s) 64
AjiI CACGTC 1 cut(s) 60
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 121
Ama87I CYCGRG 2 cut(s) 76, 146
AoxI GGCC 1 cut(s) 94
AsiGI ACCGGT 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 54
AsuII TTCGAA 1 cut(s) 126
AvaI CYCGRG 2 cut(s) 76, 146
AvaII GGWCC 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 44
BmeT110I CYCGRG 2 cut(s) 76, 146
BmgBI CACGTC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 2 cut(s) 20, 46
Bpu14I TTCGAA 1 cut(s) 126
BsaWI WCCGGW 1 cut(s) 64
Bse118I RCCGGY 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 163
BseNI ACTGG 1 cut(s) 163
BseRI GAGGAG 1 cut(s) 164
BshFI GGCC 1 cut(s) 96
BshTI ACCGGT 1 cut(s) 64
BsiHKCI CYCGRG 2 cut(s) 76, 146
BsiSI CCGG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 121
BsnI GGCC 1 cut(s) 96
BsoBI CYCGRG 2 cut(s) 76, 146
Bsp119I TTCGAA 1 cut(s) 126
BspANI GGCC 1 cut(s) 96
BspLI GGNNCC 2 cut(s) 20, 46
BspT104I TTCGAA 1 cut(s) 126
BsrFI RCCGGY 1 cut(s) 64
BsrI ACTGG 1 cut(s) 163
BssAI RCCGGY 1 cut(s) 64
BstBI TTCGAA 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 121
BsuRI GGCC 1 cut(s) 96
BtrI CACGTC 1 cut(s) 60
Cfr10I RCCGGY 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 44
CspAI ACCGGT 1 cut(s) 64
CviJI RGCY 4 cut(s) 34, 71, 81, 96
CviKI_1 RGCY 4 cut(s) 34, 71, 81, 96
Eco47I GGWCC 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 60
Eco88I CYCGRG 2 cut(s) 76, 146
EcoO109I RGGNCCY 1 cut(s) 44
FaiI YATR 1 cut(s) 102
HaeIII GGCC 1 cut(s) 96
HapII CCGG 1 cut(s) 65
HinfI GANTC 2 cut(s) 128, 159
HpaII CCGG 1 cut(s) 65
HphI GGTGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 38
HpyAV CCTTC 3 cut(s) 35, 95, 148
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 3 cut(s) 4, 51, 139
HpySE526I ACGT 1 cut(s) 59
LpnPI CCDG 6 cut(s) 44, 51, 61, 78, 158, 176
MaeII ACGT 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 60
MluCI AATT 1 cut(s) 121
MnlI CCTC 2 cut(s) 9, 142
MspI CCGG 1 cut(s) 65
NlaIV GGNNCC 2 cut(s) 20, 46
NmuCI GTSAC 1 cut(s) 60
NspV TTCGAA 1 cut(s) 126
PaeR7I CTCGAG 1 cut(s) 146
PfeI GAWTC 2 cut(s) 128, 159
PinAI ACCGGT 1 cut(s) 64
PpuMI RGGWCCY 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 20, 46
PspPI GGNCC 1 cut(s) 44
PspPPI RGGWCCY 1 cut(s) 44
PspXI VCTCGAGB 1 cut(s) 146
PsrI GAACNNNNNNTAC 2 cut(s) 11, 43
Sau96I GGNCC 1 cut(s) 44
SetI ASST 5 cut(s) 9, 36, 62, 87, 177
Sfr274I CTCGAG 1 cut(s) 146
SfuI TTCGAA 1 cut(s) 126
SinI GGWCC 1 cut(s) 44
SlaI CTCGAG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 1 cut(s) 121
TaiI ACGT 1 cut(s) 62
TaqI TCGA 2 cut(s) 126, 147
TasI AATT 1 cut(s) 121
TfiI GAWTC 2 cut(s) 128, 159
TseFI GTSAC 1 cut(s) 60
Tsp45I GTSAC 1 cut(s) 60
VpaK11BI GGWCC 1 cut(s) 44
XhoI CTCGAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.