RchiOBHm_Chr4g0432481

Multidrug Resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
56655330 .. 56655641
312 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
ATGCACCTGAGTGGAAGCAAGCCTTACTTGGTTGTTCGGTTTCTGATGGCTACGGAGCTATATGCAGGCAATTCAAGCCTATTGCTTGAGATCAGTTGTCTTAGTGTACATCCAAGAAGACAGCCACAAACTCTAAAAATAAATCAGTCATTATTGCCACATCTTGGCCCTAACAGTGATAGCTTCATCACCAAGCTTCTCCAACAATACTGTTTTGTAATTACAGGAGAGCGCTTAACAAAAAGGATTAGAGAGAGAGTGCTTGGCAAACTTTTCTCATTTGAGATAGGGTGGTTTGATCGTGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.88

Weight (kDa)

9.39

Isoelectric Point (pI)

50.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC_membrane PF00664 61 - 101 5.1e-08 ABC transporter transmembrane region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 164
AfaI GTAC 1 cut(s) 108
AfeI AGCGCT 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 1 cut(s) 75
AleI CACNNNNGTG 1 cut(s) 9
AluBI AGCT 3 cut(s) 58, 183, 196
AluI AGCT 3 cut(s) 58, 183, 196
Aor51HI AGCGCT 1 cut(s) 233
AoxI GGCC 1 cut(s) 166
AspLEI GCGC 1 cut(s) 234
AspS9I GGNCC 1 cut(s) 167
AsuHPI GGTGA 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 124
BccI CCATC 1 cut(s) 40
BfoI RGCGCY 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 124
BpuEI CTTGAG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseGI GGATG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 164
BshFI GGCC 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 164
BsnI GGCC 1 cut(s) 168
Bsp1407I TGTACA 1 cut(s) 106
Bsp143I GATC 2 cut(s) 90, 298
BspANI GGCC 1 cut(s) 168
BsrGI TGTACA 1 cut(s) 106
BssMI GATC 2 cut(s) 90, 298
Bst4CI ACNGT 2 cut(s) 176, 212
BstAUI TGTACA 1 cut(s) 106
BstC8I GCNNGC 2 cut(s) 20, 67
BstDEI CTNAG 2 cut(s) 8, 101
BstF5I GGATG 1 cut(s) 109
BstH2I RGCGCY 1 cut(s) 235
BstHHI GCGC 1 cut(s) 234
BstKTI GATC 2 cut(s) 93, 301
BstMBI GATC 2 cut(s) 90, 298
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstV2I GAAGAC 1 cut(s) 124
BsuRI GGCC 1 cut(s) 168
BtsCI GGATG 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 181
Cac8I GCNNGC 2 cut(s) 20, 67
CfoI GCGC 1 cut(s) 234
Cfr13I GGNCC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 107
CviJI RGCY 8 cut(s) 22, 50, 58, 78, 124, 168, 183, 196
CviKI_1 RGCY 8 cut(s) 22, 50, 58, 78, 124, 168, 183, 196
CviQI GTAC 1 cut(s) 107
DdeI CTNAG 2 cut(s) 8, 101
DpnI GATC 2 cut(s) 92, 300
DpnII GATC 2 cut(s) 90, 298
Eco47III AGCGCT 1 cut(s) 233
FaiI YATR 2 cut(s) 61, 63
FalI AAGNNNNNCTT 4 cut(s) 7, 39, 11, 43
FokI GGATG 1 cut(s) 96
GlaI GCGC 1 cut(s) 233
HaeII RGCGCY 1 cut(s) 235
HaeIII GGCC 1 cut(s) 168
HhaI GCGC 1 cut(s) 234
Hin6I GCGC 1 cut(s) 232
HinP1I GCGC 1 cut(s) 232
HindIII AAGCTT 1 cut(s) 194
HphI GGTGA 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 302
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 176, 212
HpyCH4V TGCA 2 cut(s) 4, 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
HpyF3I CTNAG 2 cut(s) 8, 101
HspAI GCGC 1 cut(s) 232
Kzo9I GATC 2 cut(s) 90, 298
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 3 cut(s) 20, 51, 210
MalI GATC 2 cut(s) 92, 300
MboI GATC 2 cut(s) 90, 298
MboII GAAGA 1 cut(s) 129
MluCI AATT 2 cut(s) 70, 219
MmeI TCCRAC 1 cut(s) 226
MseI TTAA 1 cut(s) 236
MslI CAYNNNNRTG 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 2 cut(s) 90, 298
OliI CACNNNNGTG 1 cut(s) 9
PflMI CCANNNNNTGG 1 cut(s) 164
PspPI GGNCC 1 cut(s) 167
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 1 cut(s) 236
Sau3AI GATC 2 cut(s) 90, 298
Sau96I GGNCC 1 cut(s) 167
SetI ASST 4 cut(s) 9, 60, 185, 198
SmiMI CAYNNNNRTG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 2 cut(s) 70, 219
TaaI ACNGT 2 cut(s) 176, 212
TasI AATT 2 cut(s) 70, 219
TatI WGTACW 1 cut(s) 106
Tru1I TTAA 1 cut(s) 236
Tru9I TTAA 1 cut(s) 236
TscAI CASTG 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 175
TspGWI ACGGA 1 cut(s) 68
TspRI CASTG 1 cut(s) 181
Van91I CCANNNNNTGG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.