Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

58587024 .. 58587598

Gene Structure 575 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGTTCTTTGGAGGTTCATCCATCTCAACATTTCATTCTTTTTTTTTTAATACTTTTTTGCAACAGACTGAATGGGCAGATGAAGTTAAGGCTTGGGAGACCTGCAGTTTGAACAAGACAGCATGCCCAGATGTGTATGTATCACAATTCATAAGCACACTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004518 GO:0004519 GO:0006139 GO:0006259 GO:0006308 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0016787 GO:0016788 GO:0019439 GO:0034641 GO:0034655 GO:0043170 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0046483 GO:0046700 GO:0071704 GO:0090304 GO:0090305 GO:1901360 GO:1901361 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

S1-P1_nuclease

Protein Analysis

54

Amino Acids

6.2

Weight (kDa)

4.5

Isoelectric Point (pI)

39.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	110
AgsI	TTSAA	1 cut(s)	112
Alw26I	GTCTC	1 cut(s)	92
ArsI	GACNNNNNNTTYG	2 cut(s)	91, 123
BccI	CCATC	1 cut(s)	29
BcoDI	GTCTC	1 cut(s)	92
BfmI	CTRYAG	1 cut(s)	103
BfuAI	ACCTGC	1 cut(s)	110
BsaI	GGTCTC	1 cut(s)	92
BseGI	GGATG	1 cut(s)	17
BsmAI	GTCTC	1 cut(s)	92
Bso31I	GGTCTC	1 cut(s)	92
BspMAI	CTGCAG	1 cut(s)	107
BspMI	ACCTGC	1 cut(s)	110
BspTNI	GGTCTC	1 cut(s)	92
BstC8I	GCNNGC	1 cut(s)	124
BstF5I	GGATG	1 cut(s)	17
BstMAI	GTCTC	1 cut(s)	92
BstNSI	RCATGY	1 cut(s)	126
BstSFI	CTRYAG	1 cut(s)	103
BtsCI	GGATG	1 cut(s)	17
BveI	ACCTGC	1 cut(s)	110
Cac8I	GCNNGC	1 cut(s)	124
CviAII	CATG	1 cut(s)	123
CviJI	RGCY	1 cut(s)	92
CviKI_1	RGCY	1 cut(s)	92
Eco31I	GGTCTC	1 cut(s)	92
FaeI	CATG	1 cut(s)	126
FaiI	YATR	4 cut(s)	124, 138, 152, 163
FatI	CATG	1 cut(s)	122
FokI	GGATG	1 cut(s)	4
FspEI	CC	9 cut(s)	34, 58, 59, 74, 79, 80, 115, 140, 141
Hin1II	CATG	1 cut(s)	126
HpyCH4V	TGCA	2 cut(s)	61, 105
Hsp92II	CATG	1 cut(s)	126
LpnPI	CCDG	2 cut(s)	115, 141
MluCI	AATT	1 cut(s)	146
MnlI	CCTC	1 cut(s)	5
MseI	TTAA	2 cut(s)	48, 87
NlaIII	CATG	1 cut(s)	126
NspI	RCATGY	1 cut(s)	126
PaeI	GCATGC	1 cut(s)	126
PstI	CTGCAG	1 cut(s)	107
SaqAI	TTAA	2 cut(s)	48, 87
SetI	ASST	2 cut(s)	16, 104
SfcI	CTRYAG	1 cut(s)	103
SgeI	CNNG	5 cut(s)	105, 114, 127, 135, 140
SphI	GCATGC	1 cut(s)	126
Sse9I	AATT	1 cut(s)	146
TasI	AATT	1 cut(s)	146
Tru1I	TTAA	2 cut(s)	48, 87
Tru9I	TTAA	2 cut(s)	48, 87
TspDTI	ATGAA	4 cut(s)	6, 23, 96, 139
XceI	RCATGY	1 cut(s)	126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.