RchiOBHm_Chr4g0436491
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
59767173 .. 59768469
1297 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGATGGATTCCTCTTCTGGTAACCACAAAATTGAAAAGGGAGGAACCTTGACTTCAAGTTTTCCTGCTAATGGGGATATGTTTGGACGAGTTGTAAATGGTACTGGTGAGACTGAAGGTAAGGATAGCTGGCCGAATCCACTTTTCCGCTACATTGTGAATCAATCTAAAACCTTGCTCATATTTCTATAA

Protein Analysis

63

Amino Acids

6.88

Weight (kDa)

6.53

Isoelectric Point (pI)

33.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 148
AcoI YGGCCR 1 cut(s) 131
AcuI CTGAAG 1 cut(s) 135
AfaI GTAC 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 2 cut(s) 35, 57
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 104
AoxI GGCC 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 119
BcoDI GTCTC 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse1I ACTGG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 109
BshFI GGCC 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 104
BsnI GGCC 1 cut(s) 133
BspACI CCGC 1 cut(s) 148
BspANI GGCC 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 46
BsrI ACTGG 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 131
BstEII GGTNACC 1 cut(s) 20
BstMAI GTCTC 1 cut(s) 104
BstPI GGTNACC 1 cut(s) 20
BsuRI GGCC 1 cut(s) 133
Cac8I GCNNGC 1 cut(s) 131
Csp6I GTAC 1 cut(s) 102
CviJI RGCY 2 cut(s) 129, 133
CviKI_1 RGCY 2 cut(s) 129, 133
CviQI GTAC 1 cut(s) 102
EaeI YGGCCR 1 cut(s) 131
Eam1104I CTCTTC 1 cut(s) 19
EarI CTCTTC 1 cut(s) 19
Eco57I CTGAAG 1 cut(s) 135
Eco91I GGTNACC 1 cut(s) 20
EcoO65I GGTNACC 1 cut(s) 20
FaiI YATR 3 cut(s) 80, 182, 190
HaeIII GGCC 1 cut(s) 133
HinfI GANTC 3 cut(s) 8, 136, 160
HphI GGTGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 110
LpnPI CCDG 4 cut(s) 3, 78, 90, 115
MaeIII GTNAC 1 cut(s) 20
MboII GAAGA 1 cut(s) 6
MluCI AATT 1 cut(s) 30
MnlI CCTC 2 cut(s) 22, 35
NlaIV GGNNCC 1 cut(s) 46
PfeI GAWTC 3 cut(s) 8, 136, 160
PspEI GGTNACC 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 46
RsaI GTAC 1 cut(s) 103
RsaNI GTAC 1 cut(s) 102
SetI ASST 4 cut(s) 50, 121, 131, 176
SgeI CNNG 8 cut(s) 30, 61, 69, 77, 101, 117, 142, 187
Sse9I AATT 1 cut(s) 30
SsiI CCGC 1 cut(s) 148
TasI AATT 1 cut(s) 30
TfiI GAWTC 3 cut(s) 8, 136, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.