RchiOBHm_Chr4g0437241

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
60398712 .. 60398870
159 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGTCAACATTCTTCAACAGAGATGATTTGATTGGATTGCTTTTGAAGGCTCTCTATCATTCTGAGTTGAACCAGAGGATTACAGTGGATGATTTAGTTGATGAGTGCAAGACATTTTACTTTGCTGGAGAGGAAACCACTAATACTTTGCTTGCTTAG

Protein Analysis

52

Amino Acids

5.99

Weight (kDa)

4.35

Isoelectric Point (pI)

35.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 16, 46, 70
BpmI CTGGAG 1 cut(s) 147
BseGI GGATG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 54
BspCNI CTCAG 1 cut(s) 55
Bst4CI ACNGT 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 2 cut(s) 63, 156
BstF5I GGATG 1 cut(s) 94
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 153
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
DdeI CTNAG 2 cut(s) 63, 156
FokI GGATG 1 cut(s) 101
FspEI CC 8 cut(s) 18, 32, 61, 71, 86, 111, 116, 151
GsuI CTGGAG 1 cut(s) 147
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 64
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 108
HpyF3I CTNAG 2 cut(s) 63, 156
LpnPI CCDG 2 cut(s) 86, 111
MboII GAAGA 1 cut(s) 4
MnlI CCTC 2 cut(s) 69, 124
SgeI CNNG 3 cut(s) 85, 121, 138
TaaI ACNGT 1 cut(s) 85
TscAI CASTG 1 cut(s) 90
TspRI CASTG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.