RchiOBHm_Chr4g0438381

Vitamin B6 photo-protection and homoeostasis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
61119452 .. 61119930
479 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGAGTTGTGTGTTGTGTTCACTTAAGGCTCTGCTGGGAGCTATTGGGGTCGGTGAGAAATCAGCCACTGTGATTGGTGCCACCTTTCAGTGGTTCTTGAGGGACTTGACTGGAATGCTGGGAGGTATCTTATTCACATTTTATCAGGTGCCATATTCTTGTTCTTTTAATCATGCTTTTCACAGTTTACATTGTAGCCTTCTGCATCCGAATATGTCTTTCTGGCCTTGGATGCTTTTGAAGGAACTAGTATGGGGTGTTCTAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF647

Protein Analysis

89

Amino Acids

9.9

Weight (kDa)

7.73

Isoelectric Point (pI)

33.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UVB_sens_prot PF04884 5 - 47 1.1e-09 Vitamin B6 photo-protection and homoeostasis domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 77, 148
AfiI CCNNNNNNNGG 1 cut(s) 90
AflII CTTAAG 1 cut(s) 23
AgsI TTSAA 1 cut(s) 241
AhlI ACTAGT 1 cut(s) 247
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AlwNI CAGNNNCTG 1 cut(s) 68
AoxI GGCC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 65
BanI GGYRCC 2 cut(s) 77, 148
BcuI ACTAGT 1 cut(s) 247
BfaI CTAG 3 cut(s) 248, 263, 268
BfrI CTTAAG 1 cut(s) 23
BmiI GGNNCC 2 cut(s) 79, 150
BmsI GCATC 2 cut(s) 214, 222
BpuEI CTTGAG 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 227
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 227
BseGI GGATG 2 cut(s) 205, 237
BseLI CCNNNNNNNGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 115
BseYI CCCAGC 2 cut(s) 34, 118
BshFI GGCC 1 cut(s) 226
BshNI GGYRCC 2 cut(s) 77, 148
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 120
BsnI GGCC 1 cut(s) 226
BspANI GGCC 1 cut(s) 226
BspLI GGNNCC 2 cut(s) 79, 150
BspT107I GGYRCC 2 cut(s) 77, 148
BspTI CTTAAG 1 cut(s) 23
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 227
BssT1I CCWWGG 1 cut(s) 227
Bst4CI ACNGT 2 cut(s) 70, 185
BstAFI CTTAAG 1 cut(s) 23
BstF5I GGATG 2 cut(s) 205, 237
BstMWI GCNNNNNNNGC 1 cut(s) 232
BsuRI GGCC 1 cut(s) 226
BtsCI GGATG 2 cut(s) 205, 237
BtsIMutI CAGTG 2 cut(s) 66, 95
CaiI CAGNNNCTG 1 cut(s) 68
CspCI CAANNNNNGTGG 2 cut(s) 55, 90
CviAII CATG 1 cut(s) 173
CviJI RGCY 6 cut(s) 29, 41, 65, 198, 226, 267
CviKI_1 RGCY 6 cut(s) 29, 41, 65, 198, 226, 267
Eco130I CCWWGG 1 cut(s) 227
EcoT14I CCWWGG 1 cut(s) 227
ErhI CCWWGG 1 cut(s) 227
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 154, 174, 215, 253
FaqI GGGAC 1 cut(s) 116
FatI CATG 1 cut(s) 172
FokI GGATG 2 cut(s) 192, 244
FspBI CTAG 3 cut(s) 248, 263, 268
GsaI CCCAGC 2 cut(s) 38, 122
HaeIII GGCC 1 cut(s) 226
Hin1II CATG 1 cut(s) 176
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 20, 188
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 2 cut(s) 20, 188
HpyAV CCTTC 2 cut(s) 209, 235
HpyCH4III ACNGT 2 cut(s) 70, 185
HpyCH4V TGCA 1 cut(s) 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
Hsp92II CATG 1 cut(s) 176
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 5 cut(s) 20, 96, 104, 131, 208
LweI GCATC 2 cut(s) 214, 222
MaeI CTAG 3 cut(s) 248, 263, 268
MnlI CCTC 2 cut(s) 93, 116
MseI TTAA 2 cut(s) 24, 168
MspCI CTTAAG 1 cut(s) 23
Mva1269I GAATGC 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 232
NlaIII CATG 1 cut(s) 176
NlaIV GGNNCC 2 cut(s) 79, 150
PctI GAATGC 1 cut(s) 120
PspFI CCCAGC 2 cut(s) 34, 118
PspN4I GGNNCC 2 cut(s) 79, 150
PsrI GAACNNNNNNTAC 1 cut(s) 243
PstNI CAGNNNCTG 1 cut(s) 68
SaqAI TTAA 2 cut(s) 24, 168
SetI ASST 4 cut(s) 43, 86, 127, 150
SfaNI GCATC 2 cut(s) 214, 222
SmlI CTYRAG 2 cut(s) 23, 97
SmoI CTYRAG 2 cut(s) 23, 97
SpeI ACTAGT 1 cut(s) 247
SspMI CTAG 3 cut(s) 248, 263, 268
StyI CCWWGG 1 cut(s) 227
TaaI ACNGT 2 cut(s) 70, 185
Tru1I TTAA 2 cut(s) 24, 168
Tru9I TTAA 2 cut(s) 24, 168
TscAI CASTG 2 cut(s) 73, 95
TspRI CASTG 2 cut(s) 73, 95
Vha464I CTTAAG 1 cut(s) 23
XspI CTAG 3 cut(s) 248, 263, 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.