RchiOBHm_Chr4g0439271

Protein of unknown function (DUF1296)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Forward (+)
61674996 .. 61677619
2624 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGCAATCTCAGCTCTCTCTCAATCCTTCTTCCTCACACCAGTTTAAGCCTGTCCTTACTGGAAGTCCCATGGGGTTTGGAAGGTTTACTAATCCAATTAATGCAATGAATGCCCCTGGTGTAGTTGGAGTTGCCATTGAGCTAGTTTTAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.36

Weight (kDa)

8.52

Isoelectric Point (pI)

42.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 13, 142
AluI AGCT 2 cut(s) 13, 142
AseI ATTAAT 1 cut(s) 99
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 2 cut(s) 143, 154
Bme1390I CCNGG 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 117
BsaJI CCNNGG 2 cut(s) 69, 115
Bse1I ACTGG 2 cut(s) 40, 64
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 69, 115
BseMI GCAATG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 23
BseNI ACTGG 2 cut(s) 40, 64
BslFI GGGAC 1 cut(s) 51
BsmFI GGGAC 1 cut(s) 51
BsmI GAATGC 1 cut(s) 115
Bsp19I CCATGG 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 111
BsrI ACTGG 2 cut(s) 40, 64
BssECI CCNNGG 2 cut(s) 69, 115
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 117
BstAPI GCANNNNNTGC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 9
BstDSI CCRYGG 1 cut(s) 69
BstMWI GCNNNNNNNGC 2 cut(s) 10, 110
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
BtgI CCRYGG 1 cut(s) 69
CviAII CATG 1 cut(s) 70
CviJI RGCY 3 cut(s) 13, 49, 142
CviKI_1 RGCY 3 cut(s) 13, 49, 142
DdeI CTNAG 1 cut(s) 9
DraI TTTAAA 1 cut(s) 150
Eco130I CCWWGG 1 cut(s) 69
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 1 cut(s) 73
FaiI YATR 1 cut(s) 71
FaqI GGGAC 1 cut(s) 51
FatI CATG 1 cut(s) 69
FspBI CTAG 2 cut(s) 143, 154
Hin1II CATG 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 87
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 36, 75
HpyCH4V TGCA 2 cut(s) 4, 104
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 110
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 1 cut(s) 73
LpnPI CCDG 5 cut(s) 45, 53, 63, 102, 129
MaeI CTAG 2 cut(s) 143, 154
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 96
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 1 cut(s) 43
MseI TTAA 3 cut(s) 45, 99, 149
MspR9I CCNGG 1 cut(s) 117
Mva1269I GAATGC 1 cut(s) 115
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 2 cut(s) 10, 110
NcoI CCATGG 1 cut(s) 69
NlaIII CATG 1 cut(s) 73
PctI GAATGC 1 cut(s) 115
PshBI ATTAAT 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
SaqAI TTAA 3 cut(s) 45, 99, 149
ScrFI CCNGG 1 cut(s) 117
SetI ASST 3 cut(s) 15, 86, 144
SgeI CNNG 6 cut(s) 52, 62, 72, 82, 128, 129
Sse9I AATT 1 cut(s) 96
SspMI CTAG 2 cut(s) 143, 154
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 69
TasI AATT 1 cut(s) 96
Tru1I TTAA 3 cut(s) 45, 99, 149
Tru9I TTAA 3 cut(s) 45, 99, 149
TspDTI ATGAA 1 cut(s) 122
VspI ATTAAT 1 cut(s) 99
XspI CTAG 2 cut(s) 143, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.