RchiOBHm_Chr4g0439781

Belongs to the RNase T2 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
62130202 .. 62130765
564 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCATGGCACTTGCTCGCAGTCTGTCCTTGATCGGTATAATTACTTCTTTCATGCTACCGGCCTCAGAGATACATTGAAAGACATCCACGGATACCTTCAAGATTATGGAATCCGACCAGATGGGACAGCGTACAACCTAAACACCCAAATATTATCTGAGAAAATCATTTCTTGGCCTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.06

Weight (kDa)

6.22

Isoelectric Point (pI)

32.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuclease_T2 PF00445 2 - 48 7.3e-06 Ribonuclease T2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 134
AgsI TTSAA 2 cut(s) 79, 101
AoxI GGCC 2 cut(s) 61, 176
BarI GAAGNNNNNNTAC 2 cut(s) 29, 61
BccI CCATC 1 cut(s) 116
BciVI GTATCC 1 cut(s) 86
BfuI GTATCC 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 88
Bse118I RCCGGY 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 84
BseMII CTCAG 2 cut(s) 79, 150
BshFI GGCC 2 cut(s) 63, 178
BsiSI CCGG 1 cut(s) 60
BslFI GGGAC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 139
BsnI GGCC 2 cut(s) 63, 178
Bsp143I GATC 1 cut(s) 31
BspANI GGCC 2 cut(s) 63, 178
BspCNI CTCAG 2 cut(s) 78, 151
BsrFI RCCGGY 1 cut(s) 59
BssAI RCCGGY 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 17
BstDEI CTNAG 2 cut(s) 65, 159
BstDSI CCRYGG 1 cut(s) 88
BstF5I GGATG 1 cut(s) 84
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BsuI GTATCC 1 cut(s) 86
BsuRI GGCC 2 cut(s) 63, 178
BtgI CCRYGG 1 cut(s) 88
BtsCI GGATG 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 17
Cfr10I RCCGGY 1 cut(s) 59
Csp6I GTAC 1 cut(s) 133
CviAII CATG 2 cut(s) 5, 53
CviJI RGCY 2 cut(s) 63, 178
CviKI_1 RGCY 2 cut(s) 63, 178
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 2 cut(s) 65, 159
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 56
FaiI YATR 4 cut(s) 6, 39, 54, 108
FaqI GGGAC 1 cut(s) 139
FatI CATG 2 cut(s) 4, 52
FokI GGATG 1 cut(s) 71
HaeIII GGCC 2 cut(s) 63, 178
HapII CCGG 1 cut(s) 60
Hin1II CATG 2 cut(s) 8, 56
HinfI GANTC 1 cut(s) 111
HpaII CCGG 1 cut(s) 60
Hpy188I TCNGA 3 cut(s) 68, 116, 160
Hpy188III TCNNGA 1 cut(s) 101
HpyAV CCTTC 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 65, 159
Hsp92II CATG 2 cut(s) 8, 56
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 2 cut(s) 73, 132
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MluCI AATT 1 cut(s) 40
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 1 cut(s) 74
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 1 cut(s) 60
NdeII GATC 1 cut(s) 31
NlaIII CATG 2 cut(s) 8, 56
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 111
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
Sau3AI GATC 1 cut(s) 31
SetI ASST 2 cut(s) 99, 141
SgeI CNNG 9 cut(s) 17, 24, 28, 41, 65, 72, 101, 113, 131
Sse9I AATT 1 cut(s) 40
SspI AATATT 1 cut(s) 153
TasI AATT 1 cut(s) 40
TfiI GAWTC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 41
TspGWI ACGGA 1 cut(s) 105
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.