RchiOBHm_Chr3g0451361
ERF Family

Belongs to the small GTPase superfamily. Arf family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0029909
Physical Location & Seq
Forward (+)
2471244 .. 2471540
297 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 297 bp
ATGAGACATTTGTTGGAAAAGAATGGGTTTCTATCTTTCTTACATAATTTGGTTTATATGAATTGCTTCATATATAAGATGGGGCTGTCTTTCACCAAAATTGTCAGTGGATATTTTGCTAAGAAAGAAATGAGTATTCTTATTGTGGATTTTGATGGCACTGGTGAGACCACCTTTTGGTTTAAGCTTAAGTTAGGGGAAATCATTACCACTATTCCTACCATTGGTATATTCGTTGCACGAAATTTTTATCTCGAGCGAATCAAATTTTTATTTTTTCGAATTACTTTTGATTGA

Protein Analysis

98

Amino Acids

11.6

Weight (kDa)

9.37

Isoelectric Point (pI)

20.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 32 - 93 5.1e-08 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029909)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0451361 RchiOBHm_Chr4g0391541

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 177
AcsI RAATTY 2 cut(s) 244, 266
AfiI CCNNNNNNNGG 2 cut(s) 177, 224
AflII CTTAAG 1 cut(s) 188
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Alw26I GTCTC 1 cut(s) 161
Ama87I CYCGRG 1 cut(s) 254
ApoI RAATTY 2 cut(s) 244, 266
Asp700I GAANNNNTTC 1 cut(s) 65
AsuHPI GGTGA 2 cut(s) 85, 176
AsuII TTCGAA 1 cut(s) 280
AvaI CYCGRG 1 cut(s) 254
BccI CCATC 2 cut(s) 73, 149
BcoDI GTCTC 1 cut(s) 161
BfrI CTTAAG 1 cut(s) 188
BmeT110I CYCGRG 1 cut(s) 254
Bpu14I TTCGAA 1 cut(s) 280
BsaI GGTCTC 1 cut(s) 161
Bsc4I CCNNNNNNNGG 2 cut(s) 177, 224
Bse1I ACTGG 1 cut(s) 166
BseLI CCNNNNNNNGG 2 cut(s) 177, 224
BseNI ACTGG 1 cut(s) 166
BsiHKCI CYCGRG 1 cut(s) 254
BslI CCNNNNNNNGG 2 cut(s) 177, 224
BsmAI GTCTC 1 cut(s) 161
Bso31I GGTCTC 1 cut(s) 161
BsoBI CYCGRG 1 cut(s) 254
Bsp119I TTCGAA 1 cut(s) 280
BspT104I TTCGAA 1 cut(s) 280
BspTI CTTAAG 1 cut(s) 188
BspTNI GGTCTC 1 cut(s) 161
BsrI ACTGG 1 cut(s) 166
BstAFI CTTAAG 1 cut(s) 188
BstBI TTCGAA 1 cut(s) 280
BstDEI CTNAG 1 cut(s) 120
BstMAI GTCTC 1 cut(s) 161
BtsIMutI CAGTG 2 cut(s) 112, 159
CviJI RGCY 2 cut(s) 85, 187
CviKI_1 RGCY 2 cut(s) 85, 187
DdeI CTNAG 1 cut(s) 120
Eco31I GGTCTC 1 cut(s) 161
Eco88I CYCGRG 1 cut(s) 254
FaiI YATR 7 cut(s) 45, 57, 59, 71, 73, 75, 230
HindIII AAGCTT 1 cut(s) 185
HinfI GANTC 1 cut(s) 261
HphI GGTGA 2 cut(s) 85, 176
Hpy188III TCNNGA 1 cut(s) 254
HpyCH4V TGCA 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 120
LpnPI CCDG 1 cut(s) 147
MluCI AATT 6 cut(s) 46, 61, 99, 244, 266, 282
MroXI GAANNNNTTC 1 cut(s) 65
MseI TTAA 2 cut(s) 183, 189
MspCI CTTAAG 1 cut(s) 188
NspV TTCGAA 1 cut(s) 280
PaeR7I CTCGAG 1 cut(s) 254
PdmI GAANNNNTTC 1 cut(s) 65
PfeI GAWTC 1 cut(s) 261
PflMI CCANNNNNTGG 1 cut(s) 177
SaqAI TTAA 2 cut(s) 183, 189
SetI ASST 2 cut(s) 176, 189
Sfr274I CTCGAG 1 cut(s) 254
SfuI TTCGAA 1 cut(s) 280
SgeI CNNG 4 cut(s) 174, 252, 266, 268
SlaI CTCGAG 1 cut(s) 254
SmlI CTYRAG 2 cut(s) 188, 254
SmoI CTYRAG 2 cut(s) 188, 254
Sse9I AATT 6 cut(s) 46, 61, 99, 244, 266, 282
TaqI TCGA 2 cut(s) 255, 280
TasI AATT 6 cut(s) 46, 61, 99, 244, 266, 282
TfiI GAWTC 1 cut(s) 261
Tru1I TTAA 2 cut(s) 183, 189
Tru9I TTAA 2 cut(s) 183, 189
TscAI CASTG 2 cut(s) 112, 166
TspDTI ATGAA 2 cut(s) 58, 74
TspRI CASTG 2 cut(s) 112, 166
Van91I CCANNNNNTGG 1 cut(s) 177
Vha464I CTTAAG 1 cut(s) 188
XapI RAATTY 2 cut(s) 244, 266
XhoI CTCGAG 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.