RchiOBHm_Chr3g0455551

Encodes a close homolog of the Cauliflower OR (Orange) protein. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
5238255 .. 5239599
1345 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGGAAGAGGCTTCAGCAAACCTTAAGCAGTATTATGCTGTTTGTTTTTCTCTTATTGCGGGAATCATCCTTTTTGGAGTTTTCCTAGCACCCGCTGCAAATGCACTATATGAAGATATGCTTGAGCGGATCAGCGGTTTGCAAAAACTTAACAGGTAG

Protein Analysis

52

Amino Acids

5.77

Weight (kDa)

5.0

Isoelectric Point (pI)

40.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 127
AciI CCGC 4 cut(s) 59, 93, 127, 135
AclWI GGATC 1 cut(s) 137
AflII CTTAAG 1 cut(s) 23
AlwI GGATC 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 95
BbvI GCAGC 1 cut(s) 82
BfaI CTAG 1 cut(s) 86
BfrI CTTAAG 1 cut(s) 23
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 143
BseGI GGATG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 82
Bsp143I GATC 1 cut(s) 129
BspACI CCGC 4 cut(s) 59, 93, 127, 135
BspPI GGATC 1 cut(s) 137
BspTI CTTAAG 1 cut(s) 23
BsrBI CCGCTC 1 cut(s) 127
BssMI GATC 1 cut(s) 129
BstAFI CTTAAG 1 cut(s) 23
BstAPI GCANNNNNTGC 1 cut(s) 95
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstMWI GCNNNNNNNGC 2 cut(s) 95, 101
BstV1I GCAGC 1 cut(s) 82
BtsCI GGATG 1 cut(s) 66
CviJI RGCY 1 cut(s) 11
CviKI_1 RGCY 1 cut(s) 11
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
FaiI YATR 4 cut(s) 36, 109, 111, 119
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FauI CCCGC 2 cut(s) 52, 100
Fnu4HI GCNGC 1 cut(s) 96
FokI GGATG 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 96
FspBI CTAG 1 cut(s) 86
GluI GCNGC 1 cut(s) 96
HinfI GANTC 1 cut(s) 63
HpyCH4V TGCA 3 cut(s) 98, 104, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 101
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 1 cut(s) 139
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 1 cut(s) 86
MalI GATC 1 cut(s) 131
MbiI CCGCTC 1 cut(s) 127
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 17, 125
MseI TTAA 2 cut(s) 24, 150
MspA1I CMGCKG 2 cut(s) 95, 135
MspCI CTTAAG 1 cut(s) 23
MwoI GCNNNNNNNGC 2 cut(s) 95, 101
NdeII GATC 1 cut(s) 129
PfeI GAWTC 1 cut(s) 63
PkrI GCNGC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 24, 150
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 1 cut(s) 129
SetI ASST 2 cut(s) 24, 158
SgeI CNNG 4 cut(s) 72, 98, 104, 134
SmlI CTYRAG 2 cut(s) 23, 122
SmoI CTYRAG 2 cut(s) 23, 122
SsiI CCGC 4 cut(s) 59, 93, 127, 135
SspMI CTAG 1 cut(s) 86
TfiI GAWTC 1 cut(s) 63
Tru1I TTAA 2 cut(s) 24, 150
Tru9I TTAA 2 cut(s) 24, 150
TseI GCWGC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 126
Vha464I CTTAAG 1 cut(s) 23
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.