RchiOBHm_Chr3g0457861

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
6782928 .. 6783410
483 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGAGATTTGAATTGAAGGATGTTAAAGTAGTATATATACATCTATATGCCATCAAGTATGACCTCATTGCTAGCTACACCAAATACGGTTTCACTAGTCCTCTAATGGCATGCTGTGGAAACGGTGGTCCTCCATACAACTACAACATGAGGCTGACATGA
Functional Annotation

Protein Analysis

53

Amino Acids

6.13

Weight (kDa)

9.0

Isoelectric Point (pI)

28.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 11, 16
AhlI ACTAGT 1 cut(s) 95
AjuI GAANNNNNNNTTGG 2 cut(s) 74, 106
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 128
AsuNHI GCTAGC 1 cut(s) 71
AvaII GGWCC 1 cut(s) 128
BccI CCATC 1 cut(s) 59
BcuI ACTAGT 1 cut(s) 95
BfaI CTAG 2 cut(s) 72, 96
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmtI GCTAGC 1 cut(s) 75
Bse3DI GCAATG 1 cut(s) 66
BseGI GGATG 1 cut(s) 25
BseMI GCAATG 1 cut(s) 66
BspOI GCTAGC 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 66
Bst4CI ACNGT 2 cut(s) 89, 125
BstC8I GCNNGC 2 cut(s) 73, 112
BstF5I GGATG 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 114
BtsCI GGATG 1 cut(s) 25
Cac8I GCNNGC 2 cut(s) 73, 112
Cfr13I GGNCC 1 cut(s) 128
CviAII CATG 3 cut(s) 111, 148, 159
CviJI RGCY 2 cut(s) 75, 154
CviKI_1 RGCY 2 cut(s) 75, 154
Eco47I GGWCC 1 cut(s) 128
FaeI CATG 3 cut(s) 114, 151, 162
FatI CATG 3 cut(s) 110, 147, 158
FokI GGATG 1 cut(s) 32
FspBI CTAG 2 cut(s) 72, 96
Hin1II CATG 3 cut(s) 114, 151, 162
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 2 cut(s) 89, 125
Hsp92II CATG 3 cut(s) 114, 151, 162
MaeI CTAG 2 cut(s) 72, 96
MluCI AATT 1 cut(s) 11
MnlI CCTC 4 cut(s) 74, 111, 141, 144
MseI TTAA 1 cut(s) 24
MslI CAYNNNNRTG 1 cut(s) 45
NheI GCTAGC 1 cut(s) 71
NlaIII CATG 3 cut(s) 114, 151, 162
NspI RCATGY 1 cut(s) 114
PaeI GCATGC 1 cut(s) 114
PspPI GGNCC 1 cut(s) 128
RseI CAYNNNNRTG 1 cut(s) 45
SaqAI TTAA 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 128
SetI ASST 2 cut(s) 66, 77
SgeI CNNG 4 cut(s) 67, 84, 108, 123
SinI GGWCC 1 cut(s) 128
SmiMI CAYNNNNRTG 1 cut(s) 45
SpeI ACTAGT 1 cut(s) 95
SphI GCATGC 1 cut(s) 114
Sse9I AATT 1 cut(s) 11
SspMI CTAG 2 cut(s) 72, 96
TaaI ACNGT 2 cut(s) 89, 125
TasI AATT 1 cut(s) 11
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
VpaK11BI GGWCC 1 cut(s) 128
XceI RCATGY 1 cut(s) 114
XspI CTAG 2 cut(s) 72, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.