RchiOBHm_Chr3g0464931

Small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
11871503 .. 11871694
192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGAGCAGGTCAGGTCAGCCCCCGGATCTGAAGAAGTACATGGACAAAAAGCTTCAAATCAAGCTAAATGCAAACCGAATGATTGTTGGAACCTTGCGTGGATTTGACCAGTTCATGAATCTGGTGGTTGATAACACTGTAGAAGATGATAAAAATGGTGATAAAAAAAATAAATTTAAAAAAAAAAGTTGA

Protein Analysis

63

Amino Acids

7.3

Weight (kDa)

9.93

Isoelectric Point (pI)

31.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM PF01423 9 - 57 8.9e-16 LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 173
AcuI CTGAAG 1 cut(s) 50
AfaI GTAC 1 cut(s) 38
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 2 cut(s) 52, 64
AluI AGCT 2 cut(s) 52, 64
AlwI GGATC 1 cut(s) 33
ApoI RAATTY 1 cut(s) 173
AsuC2I CCSGG 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 170
BcnI CCSGG 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 21
Bse1I ACTGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 21
BseNI ACTGG 1 cut(s) 109
BsiSI CCGG 1 cut(s) 23
Bsp143I GATC 1 cut(s) 25
BspHI TCATGA 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 33
BsrI ACTGG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 139
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 138
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 135
CciI TCATGA 1 cut(s) 114
Csp6I GTAC 1 cut(s) 37
CviAII CATG 2 cut(s) 40, 115
CviJI RGCY 3 cut(s) 19, 52, 64
CviKI_1 RGCY 3 cut(s) 19, 52, 64
CviQI GTAC 1 cut(s) 37
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DraI TTTAAA 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 50
FaeI CATG 2 cut(s) 43, 118
FaiI YATR 2 cut(s) 41, 116
FatI CATG 2 cut(s) 39, 114
HapII CCGG 1 cut(s) 23
Hin1II CATG 2 cut(s) 43, 118
HindIII AAGCTT 1 cut(s) 50
HinfI GANTC 1 cut(s) 118
HpaII CCGG 1 cut(s) 23
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 30
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 71
Hsp92II CATG 2 cut(s) 43, 118
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 36, 107, 122
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 2 cut(s) 43, 155
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 173
MmeI TCCRAC 1 cut(s) 67
MseI TTAA 1 cut(s) 177
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 23
NciI CCSGG 1 cut(s) 23
NdeII GATC 1 cut(s) 25
NlaIII CATG 2 cut(s) 43, 118
NlaIV GGNNCC 1 cut(s) 91
PagI TCATGA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 91
PsuI RGATCY 1 cut(s) 25
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 1 cut(s) 25
ScrFI CCNGG 1 cut(s) 23
SetI ASST 5 cut(s) 11, 16, 54, 66, 95
SfcI CTRYAG 1 cut(s) 138
Sse9I AATT 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 139
TasI AATT 1 cut(s) 173
TatI WGTACW 1 cut(s) 36
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 2 cut(s) 103, 131
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.