RchiOBHm_Chr3g0470951

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
16892995 .. 16893901
907 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGCAAATTCGAGTGGAATGGGGTAATTGGTTACACTGCATCTCTCAAATGCAATTCTGGTGCTCTCATATATTTCGAGAAGGGAATCAAGTTGCAGATGCTCTTGCAAACTTTGGTCTCACTTCAGATACTATGGTAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.46

Weight (kDa)

5.3

Isoelectric Point (pI)

-1.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 6
AcuI CTGAAG 1 cut(s) 108
Alw21I GWGCWC 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 6
BaeI ACNNNNGTAYC 1 cut(s) 120
Bbv12I GWGCWC 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 122
BmsI GCATC 2 cut(s) 48, 88
BsaI GGTCTC 1 cut(s) 122
BsiHKAI GWGCWC 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 122
Bso31I GGTCTC 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 65
BspTNI GGTCTC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 122
BtsI GCAGTG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 34
Eco31I GGTCTC 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 108
FaiI YATR 3 cut(s) 69, 71, 134
FspEI CC 9 cut(s) 4, 5, 6, 13, 43, 66, 67, 99, 119
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 74
HpyCH4V TGCA 5 cut(s) 4, 39, 52, 95, 107
LpnPI CCDG 1 cut(s) 43
LweI GCATC 2 cut(s) 48, 88
MaeIII GTNAC 1 cut(s) 30
MhlI GDGCHC 1 cut(s) 65
MluCI AATT 3 cut(s) 6, 25, 53
PfeI GAWTC 1 cut(s) 85
SduI GDGCHC 1 cut(s) 65
SfaNI GCATC 2 cut(s) 48, 88
SgeI CNNG 5 cut(s) 23, 70, 89, 101, 116
Sse9I AATT 3 cut(s) 6, 25, 53
TaqI TCGA 2 cut(s) 10, 76
TasI AATT 3 cut(s) 6, 25, 53
TfiI GAWTC 1 cut(s) 85
TscAI CASTG 1 cut(s) 41
TspRI CASTG 1 cut(s) 41
XapI RAATTY 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.