RchiOBHm_Chr3g0474181

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
19899473 .. 19900664
1192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 330 bp
ATGACTGGAGAGGTTCTTTGTAGCTTACATGCGGTTAAAGCTGTTAATCTAATCAACAAGGTCATCAAGATGCAAGACCTTGCTTTTTTCAATCAGCTTAAGGAGTTCACAATAGAGCTTTGGGGAGGATCTAATGGAATCAAATTAGCAAGGTATATTCTTGAGCATGCTCAGAATTTGGAGAAAATGGTCGTTGTTCACTTGCAAGAGCATTCTGATGTTGAAAGGTTTTTAAGTCAAAGCAAGGTGATTTCAAATGCTACACTTGTCATTAAGAGTGTACCATACTATAGTGTTGATACAGAAAATGTTTGCATTTCTATCGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.25

Weight (kDa)

6.4

Isoelectric Point (pI)

27.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029969)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0474181
rosa_samantha Rh3BG218800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 136
AcsI RAATTY 1 cut(s) 175
AfaI GTAC 1 cut(s) 282
AflII CTTAAG 1 cut(s) 98
AgsI TTSAA 3 cut(s) 91, 224, 255
AluBI AGCT 4 cut(s) 24, 41, 97, 118
AluI AGCT 4 cut(s) 24, 41, 97, 118
AlwI GGATC 1 cut(s) 136
ApoI RAATTY 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 259
BcgI CGANNNNNNTGC 1 cut(s) 304
BfmI CTRYAG 1 cut(s) 289
BfrI CTTAAG 1 cut(s) 98
BmsI GCATC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 10
BsmI GAATGC 1 cut(s) 211
Bsp143I GATC 1 cut(s) 128
BspACI CCGC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 184
BspPI GGATC 1 cut(s) 136
BspTI CTTAAG 1 cut(s) 98
BsrI ACTGG 1 cut(s) 10
BssMI GATC 1 cut(s) 128
BstAFI CTTAAG 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 171
BstKTI GATC 1 cut(s) 131
BstMBI GATC 1 cut(s) 128
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNSI RCATGY 2 cut(s) 32, 170
BstSFI CTRYAG 1 cut(s) 289
BstX2I RGATCY 1 cut(s) 128
BstYI RGATCY 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 168
Csp6I GTAC 1 cut(s) 281
CviAII CATG 2 cut(s) 29, 167
CviJI RGCY 4 cut(s) 24, 41, 97, 118
CviKI_1 RGCY 4 cut(s) 24, 41, 97, 118
CviQI GTAC 1 cut(s) 281
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 130
DpnII GATC 1 cut(s) 128
FaeI CATG 2 cut(s) 32, 170
FaiI YATR 5 cut(s) 30, 156, 168, 286, 291
FatI CATG 2 cut(s) 28, 166
GsuI CTGGAG 1 cut(s) 27
Hin1II CATG 2 cut(s) 32, 170
HinfI GANTC 1 cut(s) 138
HphI GGTGA 1 cut(s) 259
Hpy166II GTNNAC 3 cut(s) 108, 199, 281
Hpy188I TCNGA 3 cut(s) 174, 217, 326
Hpy188III TCNNGA 2 cut(s) 67, 161
Hpy8I GTNNAC 3 cut(s) 108, 199, 281
HpyCH4V TGCA 3 cut(s) 73, 205, 315
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 171
Hsp92II CATG 2 cut(s) 32, 170
Kzo9I GATC 1 cut(s) 128
LweI GCATC 1 cut(s) 60
MalI GATC 1 cut(s) 130
MboI GATC 1 cut(s) 128
MflI RGATCY 1 cut(s) 128
MluCI AATT 2 cut(s) 143, 175
MnlI CCTC 2 cut(s) 4, 119
MseI TTAA 5 cut(s) 36, 45, 99, 233, 273
MslI CAYNNNNRTG 2 cut(s) 68, 216
MspCI CTTAAG 1 cut(s) 98
Mva1269I GAATGC 1 cut(s) 211
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 1 cut(s) 128
NlaIII CATG 2 cut(s) 32, 170
NspI RCATGY 2 cut(s) 32, 170
PaeI GCATGC 1 cut(s) 170
PctI GAATGC 1 cut(s) 211
PfeI GAWTC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 128
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
RseI CAYNNNNRTG 2 cut(s) 68, 216
SaqAI TTAA 5 cut(s) 36, 45, 99, 233, 273
Sau3AI GATC 1 cut(s) 128
SfaNI GCATC 1 cut(s) 60
SfcI CTRYAG 1 cut(s) 289
SmiMI CAYNNNNRTG 2 cut(s) 68, 216
SmlI CTYRAG 2 cut(s) 98, 161
SmoI CTYRAG 2 cut(s) 98, 161
SphI GCATGC 1 cut(s) 170
Sse9I AATT 2 cut(s) 143, 175
SsiI CCGC 1 cut(s) 32
TasI AATT 2 cut(s) 143, 175
TfiI GAWTC 1 cut(s) 138
Tru1I TTAA 5 cut(s) 36, 45, 99, 233, 273
Tru9I TTAA 5 cut(s) 36, 45, 99, 233, 273
Vha464I CTTAAG 1 cut(s) 98
XapI RAATTY 1 cut(s) 175
XceI RCATGY 2 cut(s) 32, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.