RchiOBHm_Chr3g0476201

BP28CT (NUC211) domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
22185684 .. 22186501
818 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGCACGTATTTTCCTGTTCTACATCTAAGCCCATTGTTTCCCAACTTTTTATAGAACCTCCAGTTTCTCTAGAGGAGCATGTGACATTCCGTCTGTGGAAGAAGTTGATGAATTATTGGTTGTTTGTATCGTTCAAATGGCTGACTGCAGGAAGTGATCTTCTATGGAAGCCCTTGAATTATGAGGTGATGTTTCTCTACATAATAGTTTCTACTTGTTGA

Protein Analysis

73

Amino Acids

8.69

Weight (kDa)

7.8

Isoelectric Point (pI)

42.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029984)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0476201
rosa_samantha Rh3BG235100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 136, 178
AhdI GACNNNNNGTC 1 cut(s) 90
AsuHPI GGTGA 1 cut(s) 199
BfaI CTAG 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 147
BmeRI GACNNNNNGTC 1 cut(s) 90
BpmI CTGGAG 1 cut(s) 45
BsaAI YACGTR 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 62
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 89
Bsp143I GATC 1 cut(s) 157
BspMAI CTGCAG 1 cut(s) 151
BsrI ACTGG 1 cut(s) 62
BssMI GATC 1 cut(s) 157
BstBAI YACGTR 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 27
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 147
CviAII CATG 1 cut(s) 80
CviJI RGCY 3 cut(s) 31, 142, 172
CviKI_1 RGCY 3 cut(s) 31, 142, 172
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
DriI GACNNNNNGTC 1 cut(s) 90
Eam1105I GACNNNNNGTC 1 cut(s) 90
FaeI CATG 1 cut(s) 83
FaiI YATR 5 cut(s) 53, 81, 166, 183, 203
FatI CATG 1 cut(s) 79
FspBI CTAG 1 cut(s) 71
GsuI CTGGAG 1 cut(s) 45
Hin1II CATG 1 cut(s) 83
HphI GGTGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 2 cut(s) 4, 149
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 6
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 1 cut(s) 157
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 3 cut(s) 28, 75, 135
MaeI CTAG 1 cut(s) 71
MaeII ACGT 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 2 cut(s) 112, 152
MluCI AATT 2 cut(s) 112, 178
MnlI CCTC 3 cut(s) 67, 69, 178
NdeII GATC 1 cut(s) 157
NlaIII CATG 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 82
NspI RCATGY 1 cut(s) 83
Ppu21I YACGTR 1 cut(s) 7
PstI CTGCAG 1 cut(s) 151
Sau3AI GATC 1 cut(s) 157
SetI ASST 3 cut(s) 9, 61, 189
SfcI CTRYAG 1 cut(s) 147
SgeI CNNG 7 cut(s) 17, 27, 74, 83, 92, 162, 187
Sse9I AATT 2 cut(s) 112, 178
SspMI CTAG 1 cut(s) 71
TaiI ACGT 1 cut(s) 9
TasI AATT 2 cut(s) 112, 178
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 125
TspGWI ACGGA 1 cut(s) 80
XbaI TCTAGA 1 cut(s) 70
XceI RCATGY 1 cut(s) 83
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.