RchiOBHm_Chr3g0478061

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
23905922 .. 23907505
1584 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
ATGAATGACATGCTTCCAAGCTTGGAAGAACAGGGAGTGTGTCAACTGTACCCAAAAGGCCCAAATATTGGTACACCATCACAATATGCAAGGAGAGTGGAAGAAATATCTCTTATGTTCAAGAACTTGCATCATCTTCTGAACTCATTGCGGCCCCATCAGGCTAGGGCAACACTAGTTCACATTCTAGAACTTCATATAAAACGACGTAAACAAGCTGTGGAGGATGTAAAGAGAACTTTGCTTATTGATCTCAAGGTGTCATTTGAGTTGGTGCCAACAGGAGGAGAGAAGAAGCACAGGCACTTCTGA

Protein Analysis

103

Amino Acids

11.94

Weight (kDa)

9.66

Isoelectric Point (pI)

66.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med7 PF05983 25 - 80 7.1e-17 MED7 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 274
AccB7I CCANNNNNTGG 1 cut(s) 68
AciI CCGC 1 cut(s) 151
AfaI GTAC 2 cut(s) 50, 73
AfiI CCNNNNNNNGG 2 cut(s) 68, 284
AgsI TTSAA 1 cut(s) 121
AhlI ACTAGT 1 cut(s) 175
AluBI AGCT 2 cut(s) 21, 218
AluI AGCT 2 cut(s) 21, 218
AoxI GGCC 2 cut(s) 58, 152
AspS9I GGNCC 2 cut(s) 59, 153
BanI GGYRCC 1 cut(s) 274
BccI CCATC 2 cut(s) 85, 165
BcuI ACTAGT 1 cut(s) 175
BfaI CTAG 3 cut(s) 165, 176, 188
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
BmgT120I GGNCC 2 cut(s) 59, 153
BmiI GGNNCC 2 cut(s) 155, 276
BmsI GCATC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 239
Bsc4I CCNNNNNNNGG 2 cut(s) 68, 284
Bse3DI GCAATG 1 cut(s) 146
BseGI GGATG 1 cut(s) 232
BseLI CCNNNNNNNGG 2 cut(s) 68, 284
BseMI GCAATG 1 cut(s) 146
BseRI GAGGAG 1 cut(s) 300
BshFI GGCC 2 cut(s) 60, 154
BshNI GGYRCC 1 cut(s) 274
BslI CCNNNNNNNGG 2 cut(s) 68, 284
BsnI GGCC 2 cut(s) 60, 154
Bsp143I GATC 1 cut(s) 250
BspACI CCGC 1 cut(s) 151
BspANI GGCC 2 cut(s) 60, 154
BspLI GGNNCC 2 cut(s) 155, 276
BspT107I GGYRCC 1 cut(s) 274
BsrDI GCAATG 1 cut(s) 146
BssMI GATC 1 cut(s) 250
Bst4CI ACNGT 1 cut(s) 48
BstF5I GGATG 1 cut(s) 232
BstKTI GATC 1 cut(s) 253
BstMBI GATC 1 cut(s) 250
BstNSI RCATGY 1 cut(s) 13
BsuRI GGCC 2 cut(s) 60, 154
BtsCI GGATG 1 cut(s) 232
Cfr13I GGNCC 2 cut(s) 59, 153
Csp6I GTAC 2 cut(s) 49, 72
CspCI CAANNNNNGTGG 2 cut(s) 78, 113
CviAII CATG 1 cut(s) 10
CviJI RGCY 5 cut(s) 21, 60, 154, 164, 218
CviKI_1 RGCY 5 cut(s) 21, 60, 154, 164, 218
CviQI GTAC 2 cut(s) 49, 72
DpnI GATC 1 cut(s) 252
DpnII GATC 1 cut(s) 250
FaeI CATG 1 cut(s) 13
FaiI YATR 5 cut(s) 11, 87, 116, 198, 200
FatI CATG 1 cut(s) 9
Fnu4HI GCNGC 1 cut(s) 152
FokI GGATG 1 cut(s) 239
Fsp4HI GCNGC 1 cut(s) 152
FspBI CTAG 3 cut(s) 165, 176, 188
GluI GCNGC 1 cut(s) 152
HaeIII GGCC 2 cut(s) 60, 154
Hin1II CATG 1 cut(s) 13
HincII GTYRAC 1 cut(s) 44
HindII GTYRAC 1 cut(s) 44
HindIII AAGCTT 1 cut(s) 19
Hpy166II GTNNAC 4 cut(s) 44, 74, 181, 212
Hpy188I TCNGA 2 cut(s) 141, 311
Hpy188III TCNNGA 2 cut(s) 121, 188
Hpy8I GTNNAC 4 cut(s) 44, 74, 181, 212
Hpy99I CGWCG 1 cut(s) 210
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4IV ACGT 1 cut(s) 208
HpyCH4V TGCA 2 cut(s) 89, 130
HpySE526I ACGT 1 cut(s) 208
Hsp92II CATG 1 cut(s) 13
Kzo9I GATC 1 cut(s) 250
LpnPI CCDG 4 cut(s) 17, 146, 267, 286
LweI GCATC 1 cut(s) 139
MaeI CTAG 3 cut(s) 165, 176, 188
MaeII ACGT 1 cut(s) 208
MalI GATC 1 cut(s) 252
MboI GATC 1 cut(s) 250
MboII GAAGA 4 cut(s) 38, 113, 128, 304
MnlI CCTC 2 cut(s) 217, 278
NdeII GATC 1 cut(s) 250
NlaIII CATG 1 cut(s) 13
NlaIV GGNNCC 2 cut(s) 155, 276
NspI RCATGY 1 cut(s) 13
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 1 cut(s) 153
PspN4I GGNNCC 2 cut(s) 155, 276
PspPI GGNCC 2 cut(s) 59, 153
RsaI GTAC 2 cut(s) 50, 73
RsaNI GTAC 2 cut(s) 49, 72
SatI GCNGC 1 cut(s) 152
Sau3AI GATC 1 cut(s) 250
Sau96I GGNCC 2 cut(s) 59, 153
SetI ASST 4 cut(s) 23, 211, 220, 261
SfaNI GCATC 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
SpeI ACTAGT 1 cut(s) 175
SsiI CCGC 1 cut(s) 151
SspI AATATT 1 cut(s) 67
SspMI CTAG 3 cut(s) 165, 176, 188
TaaI ACNGT 1 cut(s) 48
TaiI ACGT 1 cut(s) 211
TauI GCSGC 1 cut(s) 154
TspDTI ATGAA 2 cut(s) 17, 185
Van91I CCANNNNNTGG 1 cut(s) 68
XbaI TCTAGA 1 cut(s) 187
XceI RCATGY 1 cut(s) 13
XspI CTAG 3 cut(s) 165, 176, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.