RchiOBHm_Chr3g0478571

ubiquitin-NEDD8-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
24302279 .. 24303002
724 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGAAAAATGTAATGAGAAGCAAGGCAAGAAGCAGCTCCTTATTTGAAAAATACTTGGAGATGACAAAACTGCTAGACTACAACATTGAGGGTGGCTCTGTCCTTCATTTAGTGCTTGCACTACGTGGTGGTAGCCTATAG

Protein Analysis

46

Amino Acids

5.16

Weight (kDa)

9.69

Isoelectric Point (pI)

59.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 125
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 1 cut(s) 36
AluI AGCT 1 cut(s) 36
ApeKI GCWGC 1 cut(s) 33
BbvI GCAGC 1 cut(s) 45
BfaI CTAG 1 cut(s) 74
BfmI CTRYAG 1 cut(s) 137
BisI GCNGC 1 cut(s) 34
BlsI GCNGC 1 cut(s) 35
BplI GAGNNNNNCTC 2 cut(s) 80, 112
BsaAI YACGTR 1 cut(s) 125
BseXI GCAGC 1 cut(s) 45
BstBAI YACGTR 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 137
BstV1I GCAGC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 117
CviJI RGCY 3 cut(s) 36, 96, 135
CviKI_1 RGCY 3 cut(s) 36, 96, 135
DraIII CACNNNGTG 1 cut(s) 125
FaiI YATR 1 cut(s) 139
Fnu4HI GCNGC 1 cut(s) 34
Fsp4HI GCNGC 1 cut(s) 34
FspBI CTAG 1 cut(s) 74
FspEI CC 9 cut(s) 8, 41, 52, 74, 75, 78, 111, 114, 116
GluI GCNGC 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 124
LmnI GCTCC 1 cut(s) 41
Lsp1109I GCAGC 1 cut(s) 45
MaeI CTAG 1 cut(s) 74
MaeII ACGT 1 cut(s) 124
MnlI CCTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 35
Ppu21I YACGTR 1 cut(s) 125
SatI GCNGC 1 cut(s) 34
SetI ASST 2 cut(s) 38, 127
SfcI CTRYAG 1 cut(s) 137
SgeI CNNG 6 cut(s) 34, 39, 67, 86, 128, 137
SspMI CTAG 1 cut(s) 74
TaiI ACGT 1 cut(s) 127
TseI GCWGC 1 cut(s) 33
TspDTI ATGAA 2 cut(s) 17, 95
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.