RchiOBHm_Chr3g0479621

Protein of unknown function (DUF3741)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
25426328 .. 25430289
3962 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGGTCAACCTCTTTGATATGAGTGATGGGGTTTCTAGAAACAAGCTGCTCACGAATAAATCCCACCTTGATGGATGTTGTTACTCAACAGTGCTGAAGGATTCACACAATTGTGTGGAATTGACCTGTGTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.0

Weight (kDa)

5.97

Isoelectric Point (pI)

38.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 116
AleI CACNNNNGTG 1 cut(s) 111
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 46
BbvI GCAGC 1 cut(s) 33
BccI CCATC 2 cut(s) 20, 65
BfaI CTAG 1 cut(s) 36
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BseGI GGATG 1 cut(s) 80
BseXI GCAGC 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 91
BstF5I GGATG 1 cut(s) 80
BstV1I GCAGC 1 cut(s) 33
BstXI CCANNNNNNTGG 1 cut(s) 71
BtsCI GGATG 1 cut(s) 80
BtsIMutI CAGTG 1 cut(s) 96
CviJI RGCY 1 cut(s) 46
CviKI_1 RGCY 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 116
FaiI YATR 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 47
FokI GGATG 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 47
FspBI CTAG 1 cut(s) 36
GluI GCNGC 1 cut(s) 47
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 7
Hpy188III TCNNGA 2 cut(s) 36, 52
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 91
Lsp1109I GCAGC 1 cut(s) 33
MaeI CTAG 1 cut(s) 36
MaeIII GTNAC 1 cut(s) 80
MfeI CAATTG 1 cut(s) 109
MluCI AATT 2 cut(s) 109, 119
MnlI CCTC 1 cut(s) 20
MslI CAYNNNNRTG 2 cut(s) 69, 111
MunI CAATTG 1 cut(s) 109
OliI CACNNNNGTG 1 cut(s) 111
PfeI GAWTC 1 cut(s) 101
PkrI GCNGC 1 cut(s) 48
RseI CAYNNNNRTG 2 cut(s) 69, 111
SatI GCNGC 1 cut(s) 47
SetI ASST 4 cut(s) 12, 48, 69, 128
SgeI CNNG 4 cut(s) 48, 55, 64, 80
SmiMI CAYNNNNRTG 2 cut(s) 69, 111
Sse9I AATT 2 cut(s) 109, 119
SspMI CTAG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 91
TasI AATT 2 cut(s) 109, 119
TfiI GAWTC 1 cut(s) 101
TscAI CASTG 1 cut(s) 96
TseI GCWGC 1 cut(s) 46
TspRI CASTG 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 35
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.