RchiOBHm_Chr3g0481791

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
27886179 .. 27886400
222 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGCATGATGATGGGACTGAACGGCCTTCCATGAATGATGTTGTAAGAAGGCTTGAGATTGCATTGGACCTTCAACCAAGCGCACAGGGGAACGAAAACTGCACTGAAAGGATTGGTGAAACTGAAACAAGCATTAGCGAGCAAAGTTGTGCAACCAACAATTCCATTGTATGCATATCTGGGATAATCTTCTCTGAGGTCAACAATCCGAGTGGGAGATGA

Protein Analysis

73

Amino Acids

7.94

Weight (kDa)

4.34

Isoelectric Point (pI)

68.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 74
AoxI GGCC 1 cut(s) 23
AspLEI GCGC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 67
BccI CCATC 1 cut(s) 5
BceAI ACGGC 1 cut(s) 38
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BpuEI CTTGAG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 85
BshFI GGCC 1 cut(s) 25
BslFI GGGAC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 28
BsnI GGCC 1 cut(s) 25
BspANI GGCC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 187
BstC8I GCNNGC 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 195
BstHHI GCGC 1 cut(s) 83
BsuRI GGCC 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 140
CfoI GCGC 1 cut(s) 83
Cfr13I GGNCC 1 cut(s) 67
CspCI CAANNNNNGTGG 1 cut(s) 193
CviAII CATG 2 cut(s) 5, 31
CviJI RGCY 2 cut(s) 25, 52
CviKI_1 RGCY 2 cut(s) 25, 52
DdeI CTNAG 1 cut(s) 195
Eco47I GGWCC 1 cut(s) 67
EcoT22I ATGCAT 2 cut(s) 6, 176
FaeI CATG 2 cut(s) 8, 34
FaiI YATR 4 cut(s) 6, 32, 172, 176
FaqI GGGAC 1 cut(s) 28
FatI CATG 2 cut(s) 4, 30
GlaI GCGC 1 cut(s) 82
HaeIII GGCC 1 cut(s) 25
HhaI GCGC 1 cut(s) 83
Hin1II CATG 2 cut(s) 8, 34
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 2 cut(s) 196, 210
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 3 cut(s) 36, 42, 80
HpyCH4V TGCA 5 cut(s) 4, 62, 102, 152, 174
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 2 cut(s) 8, 34
HspAI GCGC 1 cut(s) 81
LpnPI CCDG 2 cut(s) 71, 165
MboII GAAGA 1 cut(s) 181
MluCI AATT 1 cut(s) 160
MnlI CCTC 1 cut(s) 190
Mph1103I ATGCAT 2 cut(s) 6, 176
MslI CAYNNNNRTG 1 cut(s) 9
NlaIII CATG 2 cut(s) 8, 34
NsiI ATGCAT 2 cut(s) 6, 176
PspPI GGNCC 1 cut(s) 67
RseI CAYNNNNRTG 1 cut(s) 9
Sau96I GGNCC 1 cut(s) 67
SetI ASST 2 cut(s) 72, 201
SgeI CNNG 8 cut(s) 17, 43, 65, 90, 98, 141, 151, 192
SinI GGWCC 1 cut(s) 67
SmiMI CAYNNNNRTG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 1 cut(s) 160
TasI AATT 1 cut(s) 160
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 47
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 67
Zsp2I ATGCAT 2 cut(s) 6, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.