RchiOBHm_Chr3g0482691

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
28736195 .. 28736848
654 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGCTAAATGTTTCTGACCAGAACAGTCTATTACATCCAAGCCCAAGTCAAGGACGGATGTGGTATCATTGCCGCATGGTCTATTTGCTAGTGTCTTACTTCTATGGAAAGCAGTTTGTTGGTCCAGTCACACCTAACAGTTTTGTCTTTGAGAAAGGAGCTTTTTAA

Protein Analysis

55

Amino Acids

6.38

Weight (kDa)

8.98

Isoelectric Point (pI)

31.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 50
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 122
AvaII GGWCC 1 cut(s) 122
BfaI CTAG 1 cut(s) 89
BisI GCNGC 1 cut(s) 73
BlsI GCNGC 1 cut(s) 74
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
Bsc4I CCNNNNNNNGG 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 67
BseGI GGATG 2 cut(s) 34, 63
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMI GCAATG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 125
BslI CCNNNNNNNGG 1 cut(s) 50
BspACI CCGC 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 67
BsrI ACTGG 1 cut(s) 125
Bst4CI ACNGT 2 cut(s) 26, 140
BstF5I GGATG 2 cut(s) 34, 63
BtsCI GGATG 2 cut(s) 34, 63
Cfr13I GGNCC 1 cut(s) 122
CviAII CATG 1 cut(s) 76
CviJI RGCY 2 cut(s) 42, 161
CviKI_1 RGCY 2 cut(s) 42, 161
Eco47I GGWCC 1 cut(s) 122
FaeI CATG 1 cut(s) 79
FaiI YATR 2 cut(s) 77, 105
FatI CATG 1 cut(s) 75
Fnu4HI GCNGC 1 cut(s) 73
FokI GGATG 2 cut(s) 21, 70
Fsp4HI GCNGC 1 cut(s) 73
FspBI CTAG 1 cut(s) 89
GluI GCNGC 1 cut(s) 73
Hin1II CATG 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 16
HpyCH4III ACNGT 2 cut(s) 26, 140
Hsp92II CATG 1 cut(s) 79
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 2 cut(s) 32, 138
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 127
MseI TTAA 1 cut(s) 166
NlaIII CATG 1 cut(s) 79
NmuCI GTSAC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 74
PspPI GGNCC 1 cut(s) 122
SaqAI TTAA 1 cut(s) 166
SatI GCNGC 1 cut(s) 73
Sau96I GGNCC 1 cut(s) 122
SetI ASST 2 cut(s) 136, 163
SgeI CNNG 7 cut(s) 31, 51, 57, 62, 88, 101, 137
SinI GGWCC 1 cut(s) 122
SsiI CCGC 1 cut(s) 73
SspMI CTAG 1 cut(s) 89
TaaI ACNGT 2 cut(s) 26, 140
TauI GCSGC 1 cut(s) 75
Tru1I TTAA 1 cut(s) 166
Tru9I TTAA 1 cut(s) 166
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspGWI ACGGA 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 122
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.