RchiOBHm_Chr3g0484441

DNA-(Apurinic or apyrimidinic site) lyase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
30807492 .. 30808208
717 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGTCAGATCATGATAGCGAGGGGCGGATTGTAACAGTAGAGTTTGATTCATTTTACCTGATAAGTGGATATGTTCCTAATTCTGGAGATGGTTTGAGGAGACTGGAGCTGGAAAAGTCAAAGCCGTTAATTTTAACTGGTGATTTGAAATTTTGA

Protein Analysis

51

Amino Acids

5.75

Weight (kDa)

4.79

Isoelectric Point (pI)

51.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AcsI RAATTY 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 148
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw26I GTCTC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 152
BccI CCATC 1 cut(s) 83
BceAI ACGGC 1 cut(s) 109
BcoDI GTCTC 1 cut(s) 94
BpmI CTGGAG 2 cut(s) 105, 125
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse1I ACTGG 2 cut(s) 108, 142
BseLI CCNNNNNNNGG 1 cut(s) 83
BseNI ACTGG 2 cut(s) 108, 142
BseRI GAGGAG 1 cut(s) 112
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 7
BspACI CCGC 1 cut(s) 25
BspHI TCATGA 1 cut(s) 10
BsrI ACTGG 2 cut(s) 108, 142
BssMI GATC 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 37
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 7
CciI TCATGA 1 cut(s) 10
CviAII CATG 1 cut(s) 11
CviJI RGCY 2 cut(s) 109, 124
CviKI_1 RGCY 2 cut(s) 109, 124
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
EciI GGCGGA 1 cut(s) 40
FaeI CATG 1 cut(s) 14
FaiI YATR 2 cut(s) 12, 72
FatI CATG 1 cut(s) 10
GsuI CTGGAG 2 cut(s) 105, 125
Hin1II CATG 1 cut(s) 14
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 152
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 2 cut(s) 11, 84
HpyCH4III ACNGT 1 cut(s) 37
Hsp92II CATG 1 cut(s) 14
Kzo9I GATC 1 cut(s) 7
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 5 cut(s) 69, 71, 89, 95, 123
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MluCI AATT 3 cut(s) 79, 129, 149
MnlI CCTC 2 cut(s) 13, 90
MseI TTAA 2 cut(s) 128, 134
NdeII GATC 1 cut(s) 7
NlaIII CATG 1 cut(s) 14
PagI TCATGA 1 cut(s) 10
PfeI GAWTC 1 cut(s) 47
SaqAI TTAA 2 cut(s) 128, 134
Sau3AI GATC 1 cut(s) 7
SetI ASST 2 cut(s) 60, 111
SgeI CNNG 7 cut(s) 23, 31, 70, 96, 116, 122, 150
Sse9I AATT 3 cut(s) 79, 129, 149
SsiI CCGC 1 cut(s) 25
TaaI ACNGT 1 cut(s) 37
TasI AATT 3 cut(s) 79, 129, 149
TfiI GAWTC 1 cut(s) 47
Tru1I TTAA 2 cut(s) 128, 134
Tru9I TTAA 2 cut(s) 128, 134
TspDTI ATGAA 1 cut(s) 39
XapI RAATTY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.