RchiOBHm_Chr3g0486531

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
33406965 .. 33407627
663 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGATGAGGTCGTTCGATGTTTTCCAAGGCATTGTGGATGTATCTACTTCTACTGTGGTTCTTCAAGTTCAGCATCCTGAGAGGACGCTTCTGTATTCAATGCGGTTATGGGGTGAAACTATTGAAGTTCTGCGCATTGCATCCGATCATTGTTTGGAAAGTGGCTTCTCAGTCTGA

Protein Analysis

58

Amino Acids

6.62

Weight (kDa)

5.01

Isoelectric Point (pI)

36.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 134
AciI CCGC 1 cut(s) 103
AgsI TTSAA 3 cut(s) 65, 99, 125
AspLEI GCGC 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 125
BmsI GCATC 2 cut(s) 82, 149
BsaJI CCNNGG 1 cut(s) 25
Bse3DI GCAATG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 25
BseGI GGATG 3 cut(s) 43, 73, 140
BseMI GCAATG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 69
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 70
BsrDI GCAATG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 1 cut(s) 145
BssT1I CCWWGG 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 55
BstDEI CTNAG 2 cut(s) 78, 169
BstF5I GGATG 3 cut(s) 43, 73, 140
BstHHI GCGC 1 cut(s) 135
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BtsCI GGATG 3 cut(s) 43, 73, 140
CfoI GCGC 1 cut(s) 135
CseI GACGC 1 cut(s) 94
CviJI RGCY 1 cut(s) 165
CviKI_1 RGCY 1 cut(s) 165
DdeI CTNAG 2 cut(s) 78, 169
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 25
EcoT14I CCWWGG 1 cut(s) 25
ErhI CCWWGG 1 cut(s) 25
FaiI YATR 1 cut(s) 109
FokI GGATG 3 cut(s) 50, 60, 127
FspI TGCGCA 1 cut(s) 134
GlaI GCGC 1 cut(s) 134
HgaI GACGC 1 cut(s) 94
HhaI GCGC 1 cut(s) 135
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HphI GGTGA 1 cut(s) 125
Hpy188I TCNGA 2 cut(s) 145, 176
Hpy188III TCNNGA 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 78, 169
HspAI GCGC 1 cut(s) 133
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 90
LweI GCATC 2 cut(s) 82, 149
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 53
MnlI CCTC 1 cut(s) 75
NdeII GATC 1 cut(s) 145
NsbI TGCGCA 1 cut(s) 134
Sau3AI GATC 1 cut(s) 145
SetI ASST 1 cut(s) 11
SfaNI GCATC 2 cut(s) 82, 149
SgeI CNNG 3 cut(s) 38, 77, 89
SsiI CCGC 1 cut(s) 103
StyI CCWWGG 1 cut(s) 25
TaaI ACNGT 1 cut(s) 55
TaqI TCGA 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.