RchiOBHm_Chr3g0486751

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
33671969 .. 33672355
387 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
ATGGAGCTTGGTAGAGAAATTCATGACTATGTTAGAGCTGAGCTTAAGTTCACTACTATAATCGGAAATTTGGTGTTGCATGTATATGCTATGTGTGGTTATTTAAGTGAAGCAAGGAAAGTTTTCGATGAAATTCCGTTGAAAAATGTCTTGTGTTGGACTACTATGATGAATGGGTATGTGAATTGTGGTATGCTAGATGAGGCTAGAAAGTTGTTTGATAGGAGTCTTACTAAGGATGTTGTTCTATGGACAGCTATGATGAATGGAATGTACAATATAACCAATTTGATGAAGCAGTGGCTATATTCCAAGAGATGCAATTTAGATGAGTTCAAGTGGATAAATTCACAGTCGTTGCACTCCTCACAGGCTATGCTCAGTTGA

Protein Analysis

128

Amino Acids

14.99

Weight (kDa)

7.67

Isoelectric Point (pI)

31.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR PF01535 52 - 76 5.6e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 18, 67, 132, 346
AfaI GTAC 1 cut(s) 275
AflII CTTAAG 1 cut(s) 44
AgsI TTSAA 2 cut(s) 142, 337
AluBI AGCT 4 cut(s) 7, 38, 43, 257
AluI AGCT 4 cut(s) 7, 38, 43, 257
ApoI RAATTY 4 cut(s) 18, 67, 132, 346
Asp700I GAANNNNTTC 1 cut(s) 122
BfaI CTAG 2 cut(s) 197, 207
BfrI CTTAAG 1 cut(s) 44
BlpI GCTNAGC 1 cut(s) 39
BmsI GCATC 1 cut(s) 308
Bpu1102I GCTNAGC 1 cut(s) 39
BseGI GGATG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 355
Bsp1407I TGTACA 1 cut(s) 273
Bsp1720I GCTNAGC 1 cut(s) 39
BspCNI CTCAG 1 cut(s) 31
BspHI TCATGA 1 cut(s) 22
BspTI CTTAAG 1 cut(s) 44
BsrGI TGTACA 1 cut(s) 273
Bst4CI ACNGT 1 cut(s) 354
BstAFI CTTAAG 1 cut(s) 44
BstAUI TGTACA 1 cut(s) 273
BstDEI CTNAG 3 cut(s) 39, 234, 380
BstF5I GGATG 1 cut(s) 244
BstNSI RCATGY 1 cut(s) 83
BtsCI GGATG 1 cut(s) 244
BtsI GCAGTG 1 cut(s) 305
BtsIMutI CAGTG 1 cut(s) 305
CciI TCATGA 1 cut(s) 22
Csp6I GTAC 1 cut(s) 274
CviAII CATG 2 cut(s) 23, 80
CviJI RGCY 7 cut(s) 7, 38, 43, 206, 257, 304, 374
CviKI_1 RGCY 7 cut(s) 7, 38, 43, 206, 257, 304, 374
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 3 cut(s) 39, 234, 380
FaeI CATG 2 cut(s) 26, 83
FatI CATG 2 cut(s) 22, 79
FokI GGATG 1 cut(s) 251
FspBI CTAG 2 cut(s) 197, 207
Hin1II CATG 2 cut(s) 26, 83
HinfI GANTC 1 cut(s) 226
Hpy166II GTNNAC 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 65
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 51
HpyCH4III ACNGT 1 cut(s) 354
HpyCH4V TGCA 3 cut(s) 79, 321, 361
HpyF3I CTNAG 3 cut(s) 39, 234, 380
Hsp92II CATG 2 cut(s) 26, 83
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 356
LweI GCATC 1 cut(s) 308
MaeI CTAG 2 cut(s) 197, 207
MluCI AATT 7 cut(s) 18, 67, 132, 184, 286, 322, 346
MlyI GAGTC 1 cut(s) 235
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 2 cut(s) 196, 376
MroXI GAANNNNTTC 1 cut(s) 122
MseI TTAA 2 cut(s) 45, 104
MslI CAYNNNNRTG 2 cut(s) 27, 84
MspCI CTTAAG 1 cut(s) 44
NlaIII CATG 2 cut(s) 26, 83
NspI RCATGY 1 cut(s) 83
PagI TCATGA 1 cut(s) 22
PdmI GAANNNNTTC 1 cut(s) 122
PleI GAGTC 1 cut(s) 234
PpsI GAGTC 1 cut(s) 234
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
RseI CAYNNNNRTG 2 cut(s) 27, 84
SaqAI TTAA 2 cut(s) 45, 104
SchI GAGTC 1 cut(s) 235
SetI ASST 4 cut(s) 9, 40, 45, 259
SfaNI GCATC 1 cut(s) 308
SmiMI CAYNNNNRTG 2 cut(s) 27, 84
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 7 cut(s) 18, 67, 132, 184, 286, 322, 346
SspMI CTAG 2 cut(s) 197, 207
TaaI ACNGT 1 cut(s) 354
TaqI TCGA 1 cut(s) 126
TasI AATT 7 cut(s) 18, 67, 132, 184, 286, 322, 346
TatI WGTACW 1 cut(s) 273
Tru1I TTAA 2 cut(s) 45, 104
Tru9I TTAA 2 cut(s) 45, 104
TscAI CASTG 1 cut(s) 305
TspDTI ATGAA 5 cut(s) 11, 144, 185, 278, 308
TspGWI ACGGA 1 cut(s) 126
TspRI CASTG 1 cut(s) 305
Vha464I CTTAAG 1 cut(s) 44
XapI RAATTY 4 cut(s) 18, 67, 132, 346
XceI RCATGY 1 cut(s) 83
XmnI GAANNNNTTC 1 cut(s) 122
XspI CTAG 2 cut(s) 197, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.