RchiOBHm_Chr3g0487251

ATP synthase subunit alpha

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
34441190 .. 34442858
1669 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGATAAGGAATTTTCTTGTTGATTTACGTACTTATTTAAAAACGAATAAACCACAGTTCCAAGAAATCATATCTTCTGCGATGTTAGGAAGTCCAATACCTTGTCTCAAGGAGATATTGTTCAACAGACTCCAGCTGTTCTAA

Protein Analysis

47

Amino Acids

5.54

Weight (kDa)

9.62

Isoelectric Point (pI)

47.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AfaI GTAC 1 cut(s) 31
AgsI TTSAA 1 cut(s) 124
AloI GAACNNNNNNTCC 2 cut(s) 104, 136
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 110
BpmI CTGGAG 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 92
BsaAI YACGTR 1 cut(s) 29
BsaXI ACNNNNNCTCC 2 cut(s) 104, 134
BsmAI GTCTC 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 57
BstBAI YACGTR 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 110
BstSNI TACGTA 1 cut(s) 29
BtgZI GCGATG 1 cut(s) 95
Csp6I GTAC 1 cut(s) 30
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
CviQI GTAC 1 cut(s) 30
DraI TTTAAA 1 cut(s) 39
Eco105I TACGTA 1 cut(s) 29
FaiI YATR 1 cut(s) 71
FspEI CC 6 cut(s) 66, 72, 74, 95, 108, 114
GsuI CTGGAG 1 cut(s) 116
HinfI GANTC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4IV ACGT 1 cut(s) 28
HpySE526I ACGT 1 cut(s) 28
MaeII ACGT 1 cut(s) 28
MboII GAAGA 1 cut(s) 66
MluCI AATT 1 cut(s) 10
MlyI GAGTC 1 cut(s) 123
MseI TTAA 1 cut(s) 38
MspA1I CMGCKG 1 cut(s) 136
PleI GAGTC 1 cut(s) 123
PpsI GAGTC 1 cut(s) 123
Ppu21I YACGTR 1 cut(s) 29
PvuII CAGCTG 1 cut(s) 136
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SaqAI TTAA 1 cut(s) 38
SchI GAGTC 1 cut(s) 123
SetI ASST 3 cut(s) 31, 103, 138
SgeI CNNG 4 cut(s) 29, 74, 114, 121
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SnaBI TACGTA 1 cut(s) 29
Sse9I AATT 1 cut(s) 10
TaaI ACNGT 1 cut(s) 57
TaiI ACGT 1 cut(s) 31
TasI AATT 1 cut(s) 10
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.