RchiOBHm_Chr3g0491861

Belongs to the eukaryotic ribosomal protein P1 P2 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
38597496 .. 38598682
1187 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 123 bp
ATGAAGGTTGTTGCCGCATATTTGCTCACTATTTTGGGCGGCAACGCCAGCCTCTCCGCCAAGGACTTGAAGACCGTTTTCGCCTCCGCCATATTAGTTATCGTTGGATCTATCACTCGGTGA

Protein Analysis

40

Amino Acids

4.11

Weight (kDa)

10.0

Isoelectric Point (pI)

11.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 15, 39, 57, 87
AclWI GGATC 1 cut(s) 115
AdeI CACNNNGTG 1 cut(s) 120
AgsI TTSAA 1 cut(s) 70
AlwI GGATC 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 77
BisI GCNGC 2 cut(s) 15, 40
BlsI GCNGC 2 cut(s) 16, 41
BpiI GAAGAC 1 cut(s) 77
BsaJI CCNNGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 60
Bsp143I GATC 1 cut(s) 107
BspACI CCGC 4 cut(s) 15, 39, 57, 87
BspPI GGATC 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 60
Bst4CI ACNGT 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 49
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstV2I GAAGAC 1 cut(s) 77
BstX2I RGATCY 1 cut(s) 107
BstYI RGATCY 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 49
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
DraIII CACNNNGTG 1 cut(s) 120
EciI GGCGGA 2 cut(s) 46, 76
Eco130I CCWWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaiI YATR 2 cut(s) 19, 92
Fnu4HI GCNGC 2 cut(s) 15, 40
Fsp4HI GCNGC 2 cut(s) 15, 40
GluI GCNGC 2 cut(s) 15, 40
HpyCH4III ACNGT 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
Kzo9I GATC 1 cut(s) 107
LpnPI CCDG 1 cut(s) 61
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MboII GAAGA 1 cut(s) 82
MflI RGATCY 1 cut(s) 107
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 2 cut(s) 62, 94
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 1 cut(s) 107
PkrI GCNGC 2 cut(s) 16, 41
PsuI RGATCY 1 cut(s) 107
SatI GCNGC 2 cut(s) 15, 40
Sau3AI GATC 1 cut(s) 107
SetI ASST 1 cut(s) 9
SgeI CNNG 3 cut(s) 60, 73, 79
SsiI CCGC 4 cut(s) 15, 39, 57, 87
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 76
TauI GCSGC 2 cut(s) 17, 42
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.