RchiOBHm_Chr3g0492301

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Forward (+)
39051520 .. 39052225
706 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGCATATTAGACGAGCTATCATCATATGCTCCTCTATTCCCCTGATGGGTTGTGTATTGACTACTCTTGTTCATCTGTTTTCTTCTTCTCAGTCGGACAGTGAAGACGACGTGATGAGAGGCAGGGAAGACGAAGTTACTTCTTCAAGTAATGCAACAGCTCAAAAGCATTTCAGGCAACTTCAATGCATCAGAACCGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.48

Weight (kDa)

6.81

Isoelectric Point (pI)

68.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 198
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 2 cut(s) 147, 185
AjiI CACGTC 1 cut(s) 112
AluBI AGCT 2 cut(s) 17, 161
AluI AGCT 2 cut(s) 17, 161
BbsI GAAGAC 2 cut(s) 111, 135
BccI CCATC 1 cut(s) 40
BmgBI CACGTC 1 cut(s) 112
BmsI GCATC 1 cut(s) 198
BpiI GAAGAC 2 cut(s) 111, 135
Bsc4I CCNNNNNNNGG 1 cut(s) 47
BseLI CCNNNNNNNGG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 104
BseRI GAGGAG 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 47
BspACI CCGC 1 cut(s) 198
BspCNI CTCAG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 90
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstV2I GAAGAC 2 cut(s) 111, 135
BtrI CACGTC 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 106
CviJI RGCY 2 cut(s) 17, 161
CviKI_1 RGCY 2 cut(s) 17, 161
DdeI CTNAG 1 cut(s) 90
EcoT22I ATGCAT 2 cut(s) 6, 191
FaiI YATR 3 cut(s) 6, 26, 28
FauNDI CATATG 1 cut(s) 26
Hpy188I TCNGA 2 cut(s) 97, 194
Hpy99I CGWCG 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 3 cut(s) 4, 155, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 111
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 3 cut(s) 56, 109, 160
LweI GCATC 1 cut(s) 198
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 136
MboII GAAGA 5 cut(s) 75, 78, 116, 135, 140
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 2 cut(s) 43, 113
Mph1103I ATGCAT 2 cut(s) 6, 191
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeI CATATG 1 cut(s) 26
NsiI ATGCAT 2 cut(s) 6, 191
SetI ASST 3 cut(s) 19, 114, 163
SfaNI GCATC 1 cut(s) 198
SgeI CNNG 7 cut(s) 26, 55, 80, 124, 136, 159, 187
SsiI CCGC 1 cut(s) 198
TaaI ACNGT 1 cut(s) 101
TaiI ACGT 1 cut(s) 114
TscAI CASTG 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 62
TspRI CASTG 1 cut(s) 106
Zsp2I ATGCAT 2 cut(s) 6, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.