RchiOBHm_Chr3g0495911

Belongs to the pyruvate kinase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
46178497 .. 46179786
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCTTGGTGAGAGAAAGAATGTTAATCTTCCAGGGGTCGTTGTGGATCTCCCAACCTCAACAGAAAAAGACAAAGAAGATATTATCAATTGGGGGATTCCAAACAAGATTGACATGATTGCTCTGTCTTTTGTTCGAAAAGGTTCAGACCTAGTGGAGGTATGCAAGCTCCTTTGGAAAGCATGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.84

Weight (kDa)

6.14

Isoelectric Point (pI)

15.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK PF00224 2 - 58 1.6e-17 Pyruvate kinase, barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024926)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0495911 RchiOBHm_Chr5g0071261
rosa_samantha Rh3AG324900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 157
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
AlwI GGATC 1 cut(s) 54
Asp700I GAANNNNTTC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 20
AsuII TTCGAA 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 33
BfaI CTAG 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
Bpu14I TTCGAA 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 32
BseLI CCNNNNNNNGG 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 157
Bsp119I TTCGAA 1 cut(s) 136
Bsp143I GATC 1 cut(s) 46
BspPI GGATC 1 cut(s) 54
BspT104I TTCGAA 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 33
BstBI TTCGAA 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 167
BstENI CCTNNNNNAGG 1 cut(s) 155
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 167
CviAII CATG 2 cut(s) 115, 183
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EcoNI CCTNNNNNAGG 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 2 cut(s) 118, 186
FaiI YATR 3 cut(s) 116, 163, 184
FatI CATG 2 cut(s) 114, 182
FspBI CTAG 1 cut(s) 152
Hin1II CATG 2 cut(s) 118, 186
HinfI GANTC 1 cut(s) 97
HphI GGTGA 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 165
Hsp92II CATG 2 cut(s) 118, 186
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 2 cut(s) 18, 45
MaeI CTAG 1 cut(s) 152
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 2 cut(s) 20, 89
MfeI CAATTG 1 cut(s) 88
MflI RGATCY 1 cut(s) 46
MluCI AATT 1 cut(s) 88
MnlI CCTC 2 cut(s) 67, 151
MroXI GAANNNNTTC 1 cut(s) 142
MseI TTAA 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 33
MunI CAATTG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 33
NdeII GATC 1 cut(s) 46
NlaIII CATG 2 cut(s) 118, 186
NspV TTCGAA 1 cut(s) 136
PdmI GAANNNNTTC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PsuI RGATCY 1 cut(s) 46
SaqAI TTAA 1 cut(s) 24
Sau3AI GATC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 33
SetI ASST 5 cut(s) 59, 145, 153, 162, 171
SfuI TTCGAA 1 cut(s) 136
SgeI CNNG 7 cut(s) 17, 44, 45, 118, 127, 164, 178
Sse9I AATT 1 cut(s) 88
SspMI CTAG 1 cut(s) 152
StyD4I CCNGG 1 cut(s) 31
TaqI TCGA 1 cut(s) 136
TasI AATT 1 cut(s) 88
TfiI GAWTC 1 cut(s) 97
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
XagI CCTNNNNNAGG 1 cut(s) 155
XmnI GAANNNNTTC 1 cut(s) 142
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.