RchiOBHm_Chr2g0086271

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
1402049 .. 1402536
488 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 348 bp
ATGCACTTTGTCTCTAGCTATCTGGATTTATCGGAAAGTGCTGATTTGGGTAATGTGGATTTGTTTTGTGGTTCTAATGCATTCCCTTGTCTTGAGAAATTGTTCATAAACCATAGTAAAGGAATCACTTGTCTCAAAATCAGCTGTCCAAACCTCAAAGATTTGACTGTTCTTGTTTCGCTCCAAACCAGTCTGGGTAGCAAACTGTCTCTGGGTTCAACAGTTCTCAGGATGAAGGTAACGAGCCTGGATATATTTGGAACGAGAACGGAGGTATTGCTAGTCAATAGTTGCAAAATTGGAAGCTGGGTCAACATTTTTGCCCCAAAATTTGCAGTGGATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.51

Weight (kDa)

7.62

Isoelectric Point (pI)

29.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 329
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 246
AluBI AGCT 3 cut(s) 18, 144, 306
AluI AGCT 3 cut(s) 18, 144, 306
Alw26I GTCTC 3 cut(s) 16, 137, 213
ApoI RAATTY 1 cut(s) 329
Asp700I GAANNNNTTC 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 248
BcoDI GTCTC 3 cut(s) 16, 137, 213
BfaI CTAG 2 cut(s) 15, 281
Bme1390I CCNGG 1 cut(s) 248
BmrFI CCNGG 1 cut(s) 248
BpuEI CTTGAG 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 189
BseBI CCWGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 237
BseMII CTCAG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 189
BseYI CCCAGC 1 cut(s) 306
BsmAI GTCTC 3 cut(s) 16, 137, 213
BsmI GAATGC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 240
BsrI ACTGG 1 cut(s) 189
Bst2UI CCWGG 1 cut(s) 248
Bst4CI ACNGT 3 cut(s) 169, 207, 223
BstDEI CTNAG 1 cut(s) 227
BstF5I GGATG 1 cut(s) 237
BstMAI GTCTC 3 cut(s) 16, 137, 213
BstNI CCWGG 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 246
BtsCI GGATG 1 cut(s) 237
BtsI GCAGTG 1 cut(s) 342
BtsIMutI CAGTG 1 cut(s) 342
CviJI RGCY 4 cut(s) 18, 144, 246, 306
CviKI_1 RGCY 4 cut(s) 18, 144, 246, 306
DdeI CTNAG 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 246
EcoT22I ATGCAT 1 cut(s) 82
FaiI YATR 4 cut(s) 107, 114, 254, 344
FokI GGATG 1 cut(s) 244
FspBI CTAG 2 cut(s) 15, 281
GsaI CCCAGC 1 cut(s) 310
HincII GTYRAC 1 cut(s) 313
HindII GTYRAC 1 cut(s) 313
HinfI GANTC 1 cut(s) 123
Hpy166II GTNNAC 1 cut(s) 313
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 3 cut(s) 23, 92, 229
Hpy8I GTNNAC 1 cut(s) 313
HpyAV CCTTC 1 cut(s) 229
HpyCH4III ACNGT 3 cut(s) 169, 207, 223
HpyCH4V TGCA 4 cut(s) 4, 80, 294, 335
HpyF3I CTNAG 1 cut(s) 227
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 8 cut(s) 8, 179, 197, 202, 214, 233, 260, 292
MaeI CTAG 2 cut(s) 15, 281
MaeIII GTNAC 1 cut(s) 238
MluCI AATT 3 cut(s) 98, 297, 329
MnlI CCTC 2 cut(s) 164, 265
Mph1103I ATGCAT 1 cut(s) 82
MroXI GAANNNNTTC 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 144
MspR9I CCNGG 1 cut(s) 248
Mva1269I GAATGC 1 cut(s) 80
MvaI CCWGG 1 cut(s) 248
NsiI ATGCAT 1 cut(s) 82
PctI GAATGC 1 cut(s) 80
PdmI GAANNNNTTC 1 cut(s) 101
PfeI GAWTC 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 246
PspFI CCCAGC 1 cut(s) 306
PspGI CCWGG 1 cut(s) 246
PvuII CAGCTG 1 cut(s) 144
ScrFI CCNGG 1 cut(s) 248
SetI ASST 6 cut(s) 20, 146, 156, 240, 276, 308
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 3 cut(s) 98, 297, 329
SspMI CTAG 2 cut(s) 15, 281
StyD4I CCNGG 1 cut(s) 246
TaaI ACNGT 3 cut(s) 169, 207, 223
TasI AATT 3 cut(s) 98, 297, 329
TfiI GAWTC 1 cut(s) 123
TscAI CASTG 1 cut(s) 342
TspDTI ATGAA 2 cut(s) 94, 248
TspGWI ACGGA 1 cut(s) 284
TspRI CASTG 1 cut(s) 342
XapI RAATTY 1 cut(s) 329
XmnI GAANNNNTTC 1 cut(s) 101
XspI CTAG 2 cut(s) 15, 281
Zsp2I ATGCAT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.