Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1623171 .. 1624145

Gene Structure 975 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGGGTGGCGTGGGAAAATCAACTGTAGCAGTAAACTTAGCATATACTTTGGCTGGTATGGGTGCTACAGTTTGTATATTTGATGCTGATAACCCAGTGAAGAAAACCATTATTTCTACTGAATACTTGGGAGTGAAATTGGTGTCTTTTGGATTTTCCGAACAAGGTCGTGCAATAATGAGAGGCCCAATGGTCTCTGGGGTCATTGACCAGCTTCTAACTGCAACAGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006790 GO:0008150 GO:0008152 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009987 GO:0016043 GO:0016226 GO:0022607 GO:0031163 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044085 GO:0044237 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0048037 GO:0051186 GO:0051536 GO:0051540 GO:0071840

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF971 FeS_assembly_P ParA

Protein Analysis

77

Amino Acids

8.0

Weight (kDa)

6.14

Isoelectric Point (pI)

14.78

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
ParA	PF10609	2 - 76	2e-11	NUBPL iron-transfer P-loop NTPase
CbiA	PF01656	2 - 32	3.2e-08	CobQ/CobB/MinD/ParA nucleotide binding domain
AAA_31	PF13614	2 - 36	2.2e-06	AAA domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	1 cut(s)	214
AluI	AGCT	1 cut(s)	214
Alw26I	GTCTC	1 cut(s)	199
AoxI	GGCC	1 cut(s)	184
AspS9I	GGNCC	1 cut(s)	185
BcoDI	GTCTC	1 cut(s)	199
BfmI	CTRYAG	2 cut(s)	24, 66
BmgT120I	GGNCC	1 cut(s)	185
BmrI	ACTGGG	1 cut(s)	89
BmsI	GCATC	1 cut(s)	73
BmuI	ACTGGG	1 cut(s)	89
BsaI	GGTCTC	1 cut(s)	199
Bse1I	ACTGG	1 cut(s)	95
BseNI	ACTGG	1 cut(s)	95
BshFI	GGCC	1 cut(s)	186
BsmAI	GTCTC	1 cut(s)	199
BsnI	GGCC	1 cut(s)	186
Bso31I	GGTCTC	1 cut(s)	199
BspANI	GGCC	1 cut(s)	186
BspTNI	GGTCTC	1 cut(s)	199
BsrI	ACTGG	1 cut(s)	95
Bst4CI	ACNGT	2 cut(s)	25, 70
BstDEI	CTNAG	1 cut(s)	37
BstMAI	GTCTC	1 cut(s)	199
BstSFI	CTRYAG	2 cut(s)	24, 66
BsuRI	GGCC	1 cut(s)	186
BtsIMutI	CAGTG	1 cut(s)	102
Cfr13I	GGNCC	1 cut(s)	185
CviJI	RGCY	3 cut(s)	53, 186, 214
CviKI_1	RGCY	3 cut(s)	53, 186, 214
DdeI	CTNAG	1 cut(s)	37
Eco31I	GGTCTC	1 cut(s)	199
FaiI	YATR	4 cut(s)	43, 45, 59, 77
HaeIII	GGCC	1 cut(s)	186
Hpy166II	GTNNAC	1 cut(s)	34
Hpy188I	TCNGA	1 cut(s)	160
Hpy8I	GTNNAC	1 cut(s)	34
HpyCH4III	ACNGT	2 cut(s)	25, 70
HpyCH4V	TGCA	2 cut(s)	173, 224
HpyF3I	CTNAG	1 cut(s)	37
LpnPI	CCDG	4 cut(s)	39, 108, 183, 224
LweI	GCATC	1 cut(s)	73
MboII	GAAGA	1 cut(s)	112
MluCI	AATT	1 cut(s)	137
MnlI	CCTC	1 cut(s)	176
PspPI	GGNCC	1 cut(s)	185
Sau96I	GGNCC	1 cut(s)	185
SetI	ASST	2 cut(s)	169, 216
SfaNI	GCATC	1 cut(s)	73
SfcI	CTRYAG	2 cut(s)	24, 66
SgeI	CNNG	8 cut(s)	22, 66, 107, 139, 176, 182, 210, 223
Sse9I	AATT	1 cut(s)	137
TaaI	ACNGT	2 cut(s)	25, 70
TasI	AATT	1 cut(s)	137
TscAI	CASTG	1 cut(s)	102
TspRI	CASTG	1 cut(s)	102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.