RchiOBHm_Chr2g0088851

DnaJ homolog subfamily C

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
3227730 .. 3229020
1291 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGGCAGCAACTAGTGTAGAAACACCTCAGATCGTTCCTCTTCTAATGAAAGCTATAGGTTGGCAAGGTGGAAGCATACATGCTCTGCAGACCCTAGTGGTGTTTGTTACGTGGGACTATTATCCCCCACCTTATTTCCTATAA

Protein Analysis

47

Amino Acids

5.25

Weight (kDa)

5.3

Isoelectric Point (pI)

42.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AhlI ACTAGT 1 cut(s) 11
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
ApeKI GCWGC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 17
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 2 cut(s) 12, 95
BfmI CTRYAG 2 cut(s) 54, 86
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BsaAI YACGTR 1 cut(s) 111
BseMII CTCAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 17
BslFI GGGAC 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 30
BspCNI CTCAG 1 cut(s) 40
BspMAI CTGCAG 1 cut(s) 90
BssMI GATC 1 cut(s) 30
Bst6I CTCTTC 1 cut(s) 45
BstBAI YACGTR 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 27
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 2 cut(s) 54, 86
BstV1I GCAGC 1 cut(s) 17
CviAII CATG 1 cut(s) 80
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
FaeI CATG 1 cut(s) 83
FaiI YATR 4 cut(s) 56, 77, 81, 142
FaqI GGGAC 1 cut(s) 128
FatI CATG 1 cut(s) 79
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 2 cut(s) 12, 95
GluI GCNGC 1 cut(s) 6
Hin1II CATG 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 110
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 1 cut(s) 30
Lsp1109I GCAGC 1 cut(s) 17
MaeI CTAG 2 cut(s) 12, 95
MaeII ACGT 1 cut(s) 110
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 1 cut(s) 32
MnlI CCTC 2 cut(s) 36, 48
NdeII GATC 1 cut(s) 30
NlaIII CATG 1 cut(s) 83
NspI RCATGY 1 cut(s) 83
PkrI GCNGC 1 cut(s) 7
Ppu21I YACGTR 1 cut(s) 111
PstI CTGCAG 1 cut(s) 90
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 30
SetI ASST 6 cut(s) 28, 55, 61, 70, 113, 133
SfcI CTRYAG 2 cut(s) 54, 86
SgeI CNNG 5 cut(s) 24, 77, 92, 107, 123
SpeI ACTAGT 1 cut(s) 11
SspMI CTAG 2 cut(s) 12, 95
TaiI ACGT 1 cut(s) 113
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 62
XceI RCATGY 1 cut(s) 83
XspI CTAG 2 cut(s) 12, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.