RchiOBHm_Chr2g0090501

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
4344870 .. 4345229
360 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGTTTTATGGGAAAGTTTTAACTATCCATATACCAAACACATTGTTGCCTGGACTGAAATTAGGCATGAACCTTAAGACTGGACAGAGTTGGACACTGTCTTCGTGGTTCAGCGAACAACTCCCCGCACCAGGTTGTTTCAGGCTTGGCATGGATCACAGTGGCATCAACCAATTGATCATCTGGCGGCGAGAGGTCATATACTGGACTAGTGGGGTCTGGGGAAATGGAAGCTTTCAACTGGCCCCAGAACTCACAACAAGGGTTGATTTATTCGAGTCCATTTTGTTTCAAACAGGGAGGAAAAATACTTTTCTTATTCTGTTAGAAATACTTCTACTCTTTCGAAGTGGTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

119

Amino Acids

13.57

Weight (kDa)

9.65

Isoelectric Point (pI)

36.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 126, 187
AclWI GGATC 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 131
AflII CTTAAG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 239, 293
AhlI ACTAGT 1 cut(s) 209
AjnI CCWGG 2 cut(s) 49, 130
AluBI AGCT 1 cut(s) 234
AluI AGCT 1 cut(s) 234
AlwI GGATC 1 cut(s) 162
AoxI GGCC 1 cut(s) 243
ArsI GACNNNNNNTTYG 2 cut(s) 85, 117
Asp700I GAANNNNTTC 1 cut(s) 333
AspS9I GGNCC 1 cut(s) 244
AsuII TTCGAA 1 cut(s) 346
BbsI GAAGAC 1 cut(s) 93
BciT130I CCWGG 2 cut(s) 51, 132
BclI TGATCA 1 cut(s) 177
BcuI ACTAGT 1 cut(s) 209
BfaI CTAG 1 cut(s) 210
BfrI CTTAAG 1 cut(s) 74
BisI GCNGC 1 cut(s) 188
BlsI GCNGC 1 cut(s) 189
Bme1390I CCNGG 2 cut(s) 51, 132
BmgT120I GGNCC 1 cut(s) 244
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 2 cut(s) 51, 132
BmsI GCATC 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 93
Bpu14I TTCGAA 1 cut(s) 346
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse1I ACTGG 3 cut(s) 85, 209, 246
BseBI CCWGG 2 cut(s) 51, 132
BseLI CCNNNNNNNGG 1 cut(s) 131
BseNI ACTGG 3 cut(s) 85, 209, 246
BshFI GGCC 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 131
BsnI GGCC 1 cut(s) 245
Bsp119I TTCGAA 1 cut(s) 346
Bsp143I GATC 2 cut(s) 154, 177
BspACI CCGC 2 cut(s) 126, 187
BspANI GGCC 1 cut(s) 245
BspLI GGNNCC 1 cut(s) 246
BspPI GGATC 1 cut(s) 162
BspT104I TTCGAA 1 cut(s) 346
BspTI CTTAAG 1 cut(s) 74
BsrI ACTGG 3 cut(s) 85, 209, 246
BssMI GATC 2 cut(s) 154, 177
Bst2UI CCWGG 2 cut(s) 51, 132
Bst4CI ACNGT 2 cut(s) 99, 161
BstAFI CTTAAG 1 cut(s) 74
BstBI TTCGAA 1 cut(s) 346
BstKTI GATC 2 cut(s) 157, 180
BstMBI GATC 2 cut(s) 154, 177
BstNI CCWGG 2 cut(s) 51, 132
BstSCI CCNGG 2 cut(s) 49, 130
BstV2I GAAGAC 1 cut(s) 93
BsuRI GGCC 1 cut(s) 245
BtsIMutI CAGTG 2 cut(s) 95, 166
Cfr13I GGNCC 1 cut(s) 244
CsiI ACCWGGT 1 cut(s) 130
CviAII CATG 2 cut(s) 67, 151
CviJI RGCY 3 cut(s) 145, 234, 245
CviKI_1 RGCY 3 cut(s) 145, 234, 245
DpnI GATC 2 cut(s) 156, 179
DpnII GATC 2 cut(s) 154, 177
EcoRII CCWGG 2 cut(s) 49, 130
FaeI CATG 2 cut(s) 70, 154
FaiI YATR 7 cut(s) 9, 30, 32, 68, 152, 200, 202
FatI CATG 2 cut(s) 66, 150
FauI CCCGC 1 cut(s) 133
FbaI TGATCA 1 cut(s) 177
Fnu4HI GCNGC 1 cut(s) 188
Fsp4HI GCNGC 1 cut(s) 188
FspBI CTAG 1 cut(s) 210
GluI GCNGC 1 cut(s) 188
HaeIII GGCC 1 cut(s) 245
Hin1II CATG 2 cut(s) 70, 154
HindIII AAGCTT 1 cut(s) 232
HinfI GANTC 1 cut(s) 278
HpyCH4III ACNGT 2 cut(s) 99, 161
Hsp92II CATG 2 cut(s) 70, 154
Ksp22I TGATCA 1 cut(s) 177
Kzo9I GATC 2 cut(s) 154, 177
LweI GCATC 1 cut(s) 174
MabI ACCWGGT 1 cut(s) 130
MaeI CTAG 1 cut(s) 210
MalI GATC 2 cut(s) 156, 179
MboI GATC 2 cut(s) 154, 177
MboII GAAGA 1 cut(s) 93
MfeI CAATTG 1 cut(s) 173
MluCI AATT 2 cut(s) 59, 173
MlyI GAGTC 1 cut(s) 287
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 2 cut(s) 187, 294
MroXI GAANNNNTTC 1 cut(s) 333
MseI TTAA 2 cut(s) 20, 75
MspCI CTTAAG 1 cut(s) 74
MspR9I CCNGG 2 cut(s) 51, 132
MunI CAATTG 1 cut(s) 173
MvaI CCWGG 2 cut(s) 51, 132
NdeII GATC 2 cut(s) 154, 177
NlaIII CATG 2 cut(s) 70, 154
NlaIV GGNNCC 1 cut(s) 246
NspV TTCGAA 1 cut(s) 346
PdmI GAANNNNTTC 1 cut(s) 333
PflFI GACNNNGTC 1 cut(s) 97
PkrI GCNGC 1 cut(s) 189
PleI GAGTC 1 cut(s) 286
PpsI GAGTC 1 cut(s) 286
Psp6I CCWGG 2 cut(s) 49, 130
PspGI CCWGG 2 cut(s) 49, 130
PspN4I GGNNCC 1 cut(s) 246
PspPI GGNCC 1 cut(s) 244
PsyI GACNNNGTC 1 cut(s) 97
SaqAI TTAA 2 cut(s) 20, 75
SatI GCNGC 1 cut(s) 188
Sau3AI GATC 2 cut(s) 154, 177
Sau96I GGNCC 1 cut(s) 244
SchI GAGTC 1 cut(s) 287
ScrFI CCNGG 2 cut(s) 51, 132
SetI ASST 4 cut(s) 75, 136, 198, 236
SexAI ACCWGGT 1 cut(s) 130
SfaNI GCATC 1 cut(s) 174
SfuI TTCGAA 1 cut(s) 346
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SpeI ACTAGT 1 cut(s) 209
Sse9I AATT 2 cut(s) 59, 173
SsiI CCGC 2 cut(s) 126, 187
SspMI CTAG 1 cut(s) 210
StyD4I CCNGG 2 cut(s) 49, 130
TaaI ACNGT 2 cut(s) 99, 161
TaqI TCGA 2 cut(s) 276, 346
TasI AATT 2 cut(s) 59, 173
TauI GCSGC 1 cut(s) 190
Tru1I TTAA 2 cut(s) 20, 75
Tru9I TTAA 2 cut(s) 20, 75
TscAI CASTG 2 cut(s) 102, 166
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 2 cut(s) 102, 166
Tth111I GACNNNGTC 1 cut(s) 97
Vha464I CTTAAG 1 cut(s) 74
XmnI GAANNNNTTC 1 cut(s) 333
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.