RchiOBHm_Chr2g0093871

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
7012170 .. 7013308
1139 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCTACTAAAGGCTGCAGATAAGTTGCATATGACTAGGAGGGCATTCCATTTGGCCTTTGGAAGGTCAAGTCTCTTTGCTTCTTCTTTTGATGAGGTATCAACTCCTTGTTTCACTTCTTGTGCTACTTGGAATTTCAAGTGCATTAGTACAATGATTGTGATTCATGTAAGAATGGCTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.88

Weight (kDa)

9.5

Isoelectric Point (pI)

33.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 133
AfaI GTAC 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 63
AgsI TTSAA 1 cut(s) 139
Alw26I GTCTC 1 cut(s) 77
AoxI GGCC 1 cut(s) 54
ApeKI GCWGC 1 cut(s) 14
ApoI RAATTY 1 cut(s) 133
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
BmiI GGNNCC 1 cut(s) 180
Bsc4I CCNNNNNNNGG 1 cut(s) 63
BseLI CCNNNNNNNGG 1 cut(s) 63
BshFI GGCC 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 63
BsmAI GTCTC 1 cut(s) 77
BsmI GAATGC 1 cut(s) 44
BsnI GGCC 1 cut(s) 56
BspANI GGCC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 180
BspMAI CTGCAG 1 cut(s) 19
BstENI CCTNNNNNAGG 1 cut(s) 61
BstMAI GTCTC 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 15
BsuRI GGCC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 150
CviAII CATG 1 cut(s) 167
CviJI RGCY 3 cut(s) 14, 56, 179
CviKI_1 RGCY 3 cut(s) 14, 56, 179
CviQI GTAC 1 cut(s) 150
EcoNI CCTNNNNNAGG 1 cut(s) 61
FaeI CATG 1 cut(s) 170
FaiI YATR 4 cut(s) 30, 32, 168, 184
FatI CATG 1 cut(s) 166
FauNDI CATATG 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 36
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 1 cut(s) 56
Hin1II CATG 1 cut(s) 170
HinfI GANTC 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 57
HpyCH4V TGCA 3 cut(s) 17, 28, 144
Hsp92II CATG 1 cut(s) 170
LmnI GCTCC 1 cut(s) 184
MaeI CTAG 1 cut(s) 36
MboII GAAGA 1 cut(s) 75
MluCI AATT 1 cut(s) 133
MnlI CCTC 2 cut(s) 33, 88
Mva1269I GAATGC 1 cut(s) 44
NdeI CATATG 1 cut(s) 30
NlaIII CATG 1 cut(s) 170
NlaIV GGNNCC 1 cut(s) 180
PctI GAATGC 1 cut(s) 44
PfeI GAWTC 1 cut(s) 163
PkrI GCNGC 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 180
PstI CTGCAG 1 cut(s) 19
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SatI GCNGC 1 cut(s) 15
SetI ASST 2 cut(s) 68, 99
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 7 cut(s) 48, 81, 120, 132, 141, 151, 179
Sse9I AATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 36
TasI AATT 1 cut(s) 133
TatI WGTACW 1 cut(s) 149
TfiI GAWTC 1 cut(s) 163
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 155
XagI CCTNNNNNAGG 1 cut(s) 61
XapI RAATTY 1 cut(s) 133
XcmI CCANNNNNNNNNTGG 1 cut(s) 56
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.