RchiOBHm_Chr2g0093921

Histone acetyltransferase type B catalytic

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
7026398 .. 7028517
2120 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 342 bp
ATGGTTGTGGGCAAGACAGCTGCTGGACCCCTTTACAGTCACTTGATTCATCTTGTTGATGGTGCCAGTCCAATTGATCTTCTGGATCCAAGTTGGGAGTTGTATCTCCTGGTCGAGAAGAAAACAGATGAGCAAGGGGGCATCTACAATATATTGCTTGGCTTTACAGCTCTGTATCGTTTTTATCATTATCCTGACAGTTCTCGGTTGCGACTTAGCCAGATCCTGGTATTGCCTCCTTACCAGCATAAGGGTTATGGACGGTACATTCTAGAAGTTCTCAATCATGTTGCAGTATCAGAAGACATCTATGACTTCACAGTAGAAGAACCATTGGACTAA

Protein Analysis

113

Amino Acids

12.9

Weight (kDa)

5.02

Isoelectric Point (pI)

51.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 62
AccB7I CCANNNNNTGG 1 cut(s) 226
AclWI GGATC 3 cut(s) 80, 93, 217
AfaI GTAC 1 cut(s) 266
AfiI CCNNNNNNNGG 2 cut(s) 226, 250
AjnI CCWGG 2 cut(s) 108, 225
AluBI AGCT 2 cut(s) 20, 170
AluI AGCT 2 cut(s) 20, 170
AlwI GGATC 3 cut(s) 80, 93, 217
AlwNI CAGNNNCTG 2 cut(s) 23, 226
ApeKI GCWGC 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 26
AvaII GGWCC 1 cut(s) 26
BamHI GGATCC 1 cut(s) 85
BanI GGYRCC 1 cut(s) 62
BbsI GAAGAC 1 cut(s) 309
BbvI GCAGC 1 cut(s) 7
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 110, 227
BfaI CTAG 1 cut(s) 272
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
Bme1390I CCNGG 2 cut(s) 110, 227
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 3 cut(s) 28, 64, 87
BmrFI CCNGG 2 cut(s) 110, 227
BmsI GCATC 1 cut(s) 150
BpiI GAAGAC 1 cut(s) 309
Bsc4I CCNNNNNNNGG 2 cut(s) 226, 250
Bse1I ACTGG 1 cut(s) 66
BseBI CCWGG 2 cut(s) 110, 227
BseLI CCNNNNNNNGG 2 cut(s) 226, 250
BseNI ACTGG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 7
BshNI GGYRCC 1 cut(s) 62
BslI CCNNNNNNNGG 2 cut(s) 226, 250
Bsp143I GATC 3 cut(s) 76, 85, 222
BspLI GGNNCC 3 cut(s) 28, 64, 87
BspPI GGATC 3 cut(s) 80, 93, 217
BspT107I GGYRCC 1 cut(s) 62
BsrI ACTGG 1 cut(s) 66
BssMI GATC 3 cut(s) 76, 85, 222
Bst2UI CCWGG 2 cut(s) 110, 227
Bst4CI ACNGT 4 cut(s) 38, 200, 264, 322
BstDEI CTNAG 1 cut(s) 215
BstKTI GATC 3 cut(s) 79, 88, 225
BstMBI GATC 3 cut(s) 76, 85, 222
BstNI CCWGG 2 cut(s) 110, 227
BstSCI CCNGG 2 cut(s) 108, 225
BstV1I GCAGC 1 cut(s) 7
BstV2I GAAGAC 1 cut(s) 309
BstX2I RGATCY 2 cut(s) 85, 222
BstYI RGATCY 2 cut(s) 85, 222
CaiI CAGNNNCTG 2 cut(s) 23, 226
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 265
CviAII CATG 1 cut(s) 287
CviJI RGCY 4 cut(s) 20, 162, 170, 219
CviKI_1 RGCY 4 cut(s) 20, 162, 170, 219
CviQI GTAC 1 cut(s) 265
DdeI CTNAG 1 cut(s) 215
DpnI GATC 3 cut(s) 78, 87, 224
DpnII GATC 3 cut(s) 76, 85, 222
Eco47I GGWCC 1 cut(s) 26
EcoRII CCWGG 2 cut(s) 108, 225
FaeI CATG 1 cut(s) 290
FaiI YATR 5 cut(s) 152, 249, 258, 288, 312
FatI CATG 1 cut(s) 286
Fnu4HI GCNGC 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 1 cut(s) 272
GluI GCNGC 1 cut(s) 21
Hin1II CATG 1 cut(s) 290
HinfI GANTC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 301
Hpy188III TCNNGA 4 cut(s) 83, 115, 194, 272
HpyCH4III ACNGT 4 cut(s) 38, 200, 264, 322
HpyCH4V TGCA 1 cut(s) 293
HpyF3I CTNAG 1 cut(s) 215
Hsp92II CATG 1 cut(s) 290
Kzo9I GATC 3 cut(s) 76, 85, 222
Lsp1109I GCAGC 1 cut(s) 7
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 272
MaeIII GTNAC 1 cut(s) 38
MalI GATC 3 cut(s) 78, 87, 224
MboI GATC 3 cut(s) 76, 85, 222
MboII GAAGA 4 cut(s) 71, 130, 314, 338
MfeI CAATTG 1 cut(s) 72
MflI RGATCY 2 cut(s) 85, 222
MluCI AATT 1 cut(s) 72
MnlI CCTC 1 cut(s) 246
MspA1I CMGCKG 1 cut(s) 20
MspR9I CCNGG 2 cut(s) 110, 227
MunI CAATTG 1 cut(s) 72
MvaI CCWGG 2 cut(s) 110, 227
NdeII GATC 3 cut(s) 76, 85, 222
NlaIII CATG 1 cut(s) 290
NlaIV GGNNCC 3 cut(s) 28, 64, 87
NmuCI GTSAC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 46
PflMI CCANNNNNTGG 1 cut(s) 226
PkrI GCNGC 1 cut(s) 22
Psp6I CCWGG 2 cut(s) 108, 225
PspGI CCWGG 2 cut(s) 108, 225
PspN4I GGNNCC 3 cut(s) 28, 64, 87
PspPI GGNCC 1 cut(s) 26
PstNI CAGNNNCTG 2 cut(s) 23, 226
PsuI RGATCY 2 cut(s) 85, 222
PvuII CAGCTG 1 cut(s) 20
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 3 cut(s) 76, 85, 222
Sau96I GGNCC 1 cut(s) 26
ScrFI CCNGG 2 cut(s) 110, 227
SetI ASST 2 cut(s) 22, 172
SfaNI GCATC 1 cut(s) 150
SinI GGWCC 1 cut(s) 26
Sse9I AATT 1 cut(s) 72
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 2 cut(s) 108, 225
TaaI ACNGT 4 cut(s) 38, 200, 264, 322
TaqI TCGA 1 cut(s) 114
TasI AATT 1 cut(s) 72
TfiI GAWTC 1 cut(s) 46
TseFI GTSAC 1 cut(s) 38
TseI GCWGC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 38
Van91I CCANNNNNTGG 1 cut(s) 226
VpaK11BI GGWCC 1 cut(s) 26
XbaI TCTAGA 1 cut(s) 271
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.