RchiOBHm_Chr2g0102481

Belongs to the formin-like family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
13952555 .. 13953667
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGATGATGATGGGTTTCACTTTTTCCAGCTTCAGATCCGCAGCCAACCATAACCAGTCTAATAGAGGGATCAAGCCCAAAGAAGTCACGAACATAGGTATACTGTTAAGAGCGCTGAATGTAGCAAGAGATGAGGTCGTTGAAGCTCTTTCGGATGGTAAGTGA

Protein Analysis

54

Amino Acids

5.95

Weight (kDa)

9.69

Isoelectric Point (pI)

34.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 100
AciI CCGC 1 cut(s) 39
AclWI GGATC 2 cut(s) 30, 77
AcuI CTGAAG 1 cut(s) 16
AfeI AGCGCT 1 cut(s) 114
AgsI TTSAA 1 cut(s) 143
AluBI AGCT 2 cut(s) 30, 146
AluI AGCT 2 cut(s) 30, 146
AlwI GGATC 2 cut(s) 30, 77
Aor51HI AGCGCT 1 cut(s) 114
ApeKI GCWGC 1 cut(s) 41
AspLEI GCGC 1 cut(s) 115
BbvI GCAGC 1 cut(s) 53
BccI CCATC 2 cut(s) 4, 149
BfoI RGCGCY 1 cut(s) 116
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 55
BseGI GGATG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 55
BseXI GCAGC 1 cut(s) 53
Bsp143I GATC 2 cut(s) 35, 69
BspACI CCGC 1 cut(s) 39
BspPI GGATC 2 cut(s) 30, 77
BsrI ACTGG 1 cut(s) 55
BssMI GATC 2 cut(s) 35, 69
BssNAI GTATAC 1 cut(s) 101
Bst1107I GTATAC 1 cut(s) 101
Bst4CI ACNGT 1 cut(s) 105
BstF5I GGATG 1 cut(s) 160
BstH2I RGCGCY 1 cut(s) 116
BstHHI GCGC 1 cut(s) 115
BstKTI GATC 2 cut(s) 38, 72
BstMBI GATC 2 cut(s) 35, 69
BstV1I GCAGC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BstZ17I GTATAC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 160
CfoI GCGC 1 cut(s) 115
CviJI RGCY 4 cut(s) 30, 44, 76, 146
CviKI_1 RGCY 4 cut(s) 30, 44, 76, 146
DpnI GATC 2 cut(s) 37, 71
DpnII GATC 2 cut(s) 35, 69
Eco47III AGCGCT 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 16
FaiI YATR 3 cut(s) 51, 95, 101
FblI GTMKAC 1 cut(s) 100
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
GlaI GCGC 1 cut(s) 114
GluI GCNGC 1 cut(s) 42
HaeII RGCGCY 1 cut(s) 116
HhaI GCGC 1 cut(s) 115
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 101
Hpy188I TCNGA 2 cut(s) 35, 154
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 101
HpyCH4III ACNGT 1 cut(s) 105
HspAI GCGC 1 cut(s) 113
Kzo9I GATC 2 cut(s) 35, 69
LpnPI CCDG 2 cut(s) 40, 68
Lsp1109I GCAGC 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 85
MalI GATC 2 cut(s) 37, 71
MboI GATC 2 cut(s) 35, 69
MflI RGATCY 1 cut(s) 35
MnlI CCTC 2 cut(s) 59, 127
MseI TTAA 1 cut(s) 107
NdeII GATC 2 cut(s) 35, 69
NmuCI GTSAC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 35
SaqAI TTAA 1 cut(s) 107
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 2 cut(s) 35, 69
SetI ASST 4 cut(s) 32, 100, 138, 148
SgeI CNNG 5 cut(s) 39, 67, 85, 100, 138
SsiI CCGC 1 cut(s) 39
TaaI ACNGT 1 cut(s) 105
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TseFI GTSAC 1 cut(s) 85
TseI GCWGC 1 cut(s) 41
Tsp45I GTSAC 1 cut(s) 85
XmiI GTMKAC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.