RchiOBHm_Chr2g0105441

phosphotransfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
16714070 .. 16714994
925 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGTTCAAAGCTATTTTTTGTTTTCATTTTGGTGGTGAAAAGGGATTCTTGGATGATCCGTTTGCACAGCTGAAGAAGCTCCAGGATGAAAATAGTCCAGATTCTGTGGTTGAGGTTGTTTCTCTATTCTTTCAAGATTCTGAGAAGTTTCTCAACAATATGGCTAGGGCTCTAAAGTATGTTGGTGATGAGGAAATGATGCTGATCATGTATTCTAATCGGGTGAGTTCCTGTTTTATTGTATTTGGGAAATATGAATGGCTTATTGTAGCTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.67

Weight (kDa)

4.81

Isoelectric Point (pI)

32.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 92
AgsI TTSAA 2 cut(s) 7, 134
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 4 cut(s) 11, 70, 79, 272
AluI AGCT 4 cut(s) 11, 70, 79, 272
AlwI GGATC 1 cut(s) 50
AlwNI CAGNNNCTG 1 cut(s) 104
AsuHPI GGTGA 3 cut(s) 47, 197, 235
BanII GRGCYC 1 cut(s) 172
BciT130I CCWGG 1 cut(s) 83
BclI TGATCA 1 cut(s) 204
BfaI CTAG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 83
BmrFI CCNGG 1 cut(s) 83
BmsI GCATC 1 cut(s) 189
BpmI CTGGAG 1 cut(s) 65
BsaBI GATNNNNATC 1 cut(s) 203
Bse8I GATNNNNATC 1 cut(s) 203
BseBI CCWGG 1 cut(s) 83
BseGI GGATG 2 cut(s) 58, 91
BseJI GATNNNNATC 1 cut(s) 203
BseMII CTCAG 1 cut(s) 132
Bsp1286I GDGCHC 1 cut(s) 172
Bsp143I GATC 2 cut(s) 55, 204
BspCNI CTCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 50
BssMI GATC 2 cut(s) 55, 204
Bst2UI CCWGG 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 141
BstF5I GGATG 2 cut(s) 58, 91
BstKTI GATC 2 cut(s) 58, 207
BstMBI GATC 2 cut(s) 55, 204
BstMWI GCNNNNNNNGC 1 cut(s) 76
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BtsCI GGATG 2 cut(s) 58, 91
CaiI CAGNNNCTG 1 cut(s) 104
CviAII CATG 1 cut(s) 208
CviJI RGCY 7 cut(s) 11, 70, 79, 164, 170, 262, 272
CviKI_1 RGCY 7 cut(s) 11, 70, 79, 164, 170, 262, 272
DdeI CTNAG 1 cut(s) 141
DpnI GATC 2 cut(s) 57, 206
DpnII GATC 2 cut(s) 55, 204
Eco24I GRGCYC 1 cut(s) 172
Eco57I CTGAAG 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 81
EcoT38I GRGCYC 1 cut(s) 172
FaeI CATG 1 cut(s) 211
FaiI YATR 4 cut(s) 161, 180, 209, 255
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FatI CATG 1 cut(s) 207
FbaI TGATCA 1 cut(s) 204
FokI GGATG 2 cut(s) 65, 98
FriOI GRGCYC 1 cut(s) 172
FspBI CTAG 1 cut(s) 165
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 1 cut(s) 211
HinfI GANTC 3 cut(s) 45, 101, 137
HphI GGTGA 3 cut(s) 47, 197, 235
Hpy188I TCNGA 1 cut(s) 142
Hpy188III TCNNGA 2 cut(s) 98, 134
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 1 cut(s) 211
Ksp22I TGATCA 1 cut(s) 204
Kzo9I GATC 2 cut(s) 55, 204
LmnI GCTCC 1 cut(s) 84
LpnPI CCDG 4 cut(s) 68, 95, 111, 244
LweI GCATC 1 cut(s) 189
MaeI CTAG 1 cut(s) 165
MalI GATC 2 cut(s) 57, 206
MboI GATC 2 cut(s) 55, 204
MboII GAAGA 1 cut(s) 85
MhlI GDGCHC 1 cut(s) 172
MnlI CCTC 2 cut(s) 106, 184
MslI CAYNNNNRTG 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 70
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeII GATC 2 cut(s) 55, 204
NlaIII CATG 1 cut(s) 211
PfeI GAWTC 3 cut(s) 45, 101, 137
PfoI TCCNGGA 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PstNI CAGNNNCTG 1 cut(s) 104
PvuII CAGCTG 1 cut(s) 70
RseI CAYNNNNRTG 1 cut(s) 30
Sau3AI GATC 2 cut(s) 55, 204
ScrFI CCNGG 1 cut(s) 83
SduI GDGCHC 1 cut(s) 172
SetI ASST 5 cut(s) 13, 72, 81, 117, 274
SfaNI GCATC 1 cut(s) 189
SgeI CNNG 9 cut(s) 61, 94, 95, 110, 146, 177, 220, 233, 243
SmiMI CAYNNNNRTG 1 cut(s) 30
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 81
TfiI GAWTC 3 cut(s) 45, 101, 137
TspDTI ATGAA 3 cut(s) 14, 102, 270
TspGWI ACGGA 1 cut(s) 48
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.