RchiOBHm_Chr2g0113821

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
25960785 .. 25965132
4348 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 306 bp
ATGCTAGAAGAAGTCGGCATATGTCTATTCTGTAGCTTAGATGCTTTTTATAAGTCGACGTTGTGCAAAATTAATATGTTTTTGATGGTTGATATGATTTCCTTCTGCATCAGGCTATGTCAAGAATGCCAAACTTTGATTGAAAACCATTCTAAGATAAAGCTTCTCAGCAATGTGAGGAATAACTTGAATACAACCTTAAAGGTTTATGAACTTTGTTCTTATGAATTTTCAATTTTCGGTTCACAAAGAGAAGGAGATTGTGCCTGGTTAGAACTGTTTGCTTCATGCAAGAATGATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.69

Weight (kDa)

5.02

Isoelectric Point (pI)

23.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029874)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0113821
rosa_samantha Rh2CG248600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 51
AccI GTMKAC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 227
AgsI TTSAA 3 cut(s) 143, 190, 234
AjnI CCWGG 1 cut(s) 266
AluBI AGCT 2 cut(s) 36, 163
AluI AGCT 2 cut(s) 36, 163
ApoI RAATTY 1 cut(s) 227
AseI ATTAAT 1 cut(s) 72
BccI CCATC 1 cut(s) 79
BciT130I CCWGG 1 cut(s) 268
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 268
BmrFI CCNGG 1 cut(s) 268
BmsI GCATC 2 cut(s) 31, 117
Bse3DI GCAATG 1 cut(s) 178
BseBI CCWGG 1 cut(s) 268
BseMI GCAATG 1 cut(s) 178
BseMII CTCAG 1 cut(s) 181
BsmI GAATGC 1 cut(s) 131
BspCNI CTCAG 1 cut(s) 180
BsrDI GCAATG 1 cut(s) 178
Bst2UI CCWGG 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 279
BstDEI CTNAG 3 cut(s) 37, 153, 167
BstNI CCWGG 1 cut(s) 268
BstSCI CCNGG 1 cut(s) 266
BstSFI CTRYAG 1 cut(s) 31
CviAII CATG 1 cut(s) 288
CviJI RGCY 3 cut(s) 36, 115, 163
CviKI_1 RGCY 3 cut(s) 36, 115, 163
DdeI CTNAG 3 cut(s) 37, 153, 167
EcoRII CCWGG 1 cut(s) 266
FaeI CATG 1 cut(s) 291
FaiI YATR 9 cut(s) 20, 22, 51, 77, 95, 118, 210, 225, 289
FatI CATG 1 cut(s) 287
FauNDI CATATG 1 cut(s) 20
FblI GTMKAC 1 cut(s) 56
FspBI CTAG 1 cut(s) 5
Hin1II CATG 1 cut(s) 291
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HindIII AAGCTT 1 cut(s) 161
Hpy166II GTNNAC 2 cut(s) 57, 245
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 2 cut(s) 57, 245
Hpy99I CGWCG 1 cut(s) 61
HpyAV CCTTC 2 cut(s) 112, 248
HpyCH4III ACNGT 1 cut(s) 279
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 3 cut(s) 66, 108, 291
HpyF3I CTNAG 3 cut(s) 37, 153, 167
HpySE526I ACGT 1 cut(s) 59
Hsp92II CATG 1 cut(s) 291
LpnPI CCDG 3 cut(s) 97, 253, 280
LweI GCATC 2 cut(s) 31, 117
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 59
MboII GAAGA 1 cut(s) 20
MluCI AATT 4 cut(s) 69, 227, 234, 301
MnlI CCTC 1 cut(s) 171
MseI TTAA 2 cut(s) 72, 200
MspR9I CCNGG 1 cut(s) 268
Mva1269I GAATGC 1 cut(s) 131
MvaI CCWGG 1 cut(s) 268
NdeI CATATG 1 cut(s) 20
NlaIII CATG 1 cut(s) 291
PctI GAATGC 1 cut(s) 131
PshBI ATTAAT 1 cut(s) 72
PsiI TTATAA 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 266
PspGI CCWGG 1 cut(s) 266
SalI GTCGAC 1 cut(s) 55
SaqAI TTAA 2 cut(s) 72, 200
ScrFI CCNGG 1 cut(s) 268
SetI ASST 5 cut(s) 38, 62, 165, 200, 207
SfaNI GCATC 2 cut(s) 31, 117
SfcI CTRYAG 1 cut(s) 31
SgeI CNNG 7 cut(s) 17, 124, 134, 199, 279, 280, 300
Sse9I AATT 4 cut(s) 69, 227, 234, 301
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 266
TaaI ACNGT 1 cut(s) 279
TaiI ACGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 56
TasI AATT 4 cut(s) 69, 227, 234, 301
Tru1I TTAA 2 cut(s) 72, 200
Tru9I TTAA 2 cut(s) 72, 200
TspDTI ATGAA 3 cut(s) 225, 240, 276
VspI ATTAAT 1 cut(s) 72
XapI RAATTY 1 cut(s) 227
XmiI GTMKAC 1 cut(s) 56
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.