RchiOBHm_Chr2g0114091

asparagine synthetase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
26161512 .. 26161934
423 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGTTTCTTATGTCTCGTAAAATTAAATCTCTGGGAGTAAAAATGGTTCTTTCTGGGGAAGGTTCAGATGAAATCTTTGGTGGCTACTTGTATTTCCACAAGGCACCAAACAAGGAGGATTTCACCAAGAAACATGCCAGAAGATTAAAGCTCTACATCTGTAGGACTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.64

Weight (kDa)

9.93

Isoelectric Point (pI)

46.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Asn_synthase PF00733 1 - 44 3.8e-13 Asparagine synthase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 103
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
Alw26I GTCTC 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 115
BanI GGYRCC 1 cut(s) 103
BcoDI GTCTC 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 160
BmiI GGNNCC 1 cut(s) 105
BshNI GGYRCC 1 cut(s) 103
BsmAI GTCTC 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 105
BspT107I GGYRCC 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 169
BstMAI GTCTC 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 160
CviAII CATG 1 cut(s) 134
CviJI RGCY 2 cut(s) 84, 151
CviKI_1 RGCY 2 cut(s) 84, 151
FaeI CATG 1 cut(s) 137
FaiI YATR 2 cut(s) 11, 135
FatI CATG 1 cut(s) 133
Hin1II CATG 1 cut(s) 137
HphI GGTGA 1 cut(s) 115
Hpy188I TCNGA 2 cut(s) 67, 173
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 169
Hsp92II CATG 1 cut(s) 137
LpnPI CCDG 3 cut(s) 17, 39, 151
MboII GAAGA 1 cut(s) 153
MluCI AATT 1 cut(s) 21
MnlI CCTC 1 cut(s) 109
MseI TTAA 2 cut(s) 24, 146
NlaIII CATG 1 cut(s) 137
NlaIV GGNNCC 1 cut(s) 105
NspI RCATGY 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 105
PsrI GAACNNNNNNTAC 2 cut(s) 30, 62
SaqAI TTAA 2 cut(s) 24, 146
SetI ASST 2 cut(s) 64, 153
SfcI CTRYAG 1 cut(s) 160
SgeI CNNG 9 cut(s) 27, 44, 66, 100, 112, 124, 139, 146, 150
Sse9I AATT 1 cut(s) 21
TaaI ACNGT 1 cut(s) 169
TasI AATT 1 cut(s) 21
Tru1I TTAA 2 cut(s) 24, 146
Tru9I TTAA 2 cut(s) 24, 146
TspDTI ATGAA 1 cut(s) 84
XceI RCATGY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.