RchiOBHm_Chr2g0119601

mediator of RNA polymerase II transcription subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
32173977 .. 32174456
480 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGTGTGGAGGCAGGGCTAGCATTGAGTTGGGGGAGATTGTGGTGACCCAACTCTATTTCCGGCATAACAAACCTTGTCTCTGGAAATTTCTCGACTTTTGTCTCTCGTCTGGTCTCCTCTCTCCTCTTCGTGTCCTCTCTCTCCTCTCTGCCAGGGTGATTCCTCAACGGCTGTCTCAACCAGAAGCTTATAGGCTGTTTCTTGAGCTTTTGCGGTGGTATGCATTTTCATTTGGTCCGCCTGCTCCAGACGGGCACAAAAAAAAGTTTAGTGGTGGTATCATTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.81

Weight (kDa)

9.66

Isoelectric Point (pI)

58.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 214, 239
AcsI RAATTY 1 cut(s) 86
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 2 cut(s) 188, 208
AluI AGCT 2 cut(s) 188, 208
Alw26I GTCTC 4 cut(s) 83, 107, 119, 180
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 2 cut(s) 55, 169
AsuNHI GCTAGC 1 cut(s) 17
AvaII GGWCC 1 cut(s) 236
BaeGI GKGCMC 1 cut(s) 258
BceAI ACGGC 1 cut(s) 185
BciT130I CCWGG 1 cut(s) 154
BcoDI GTCTC 4 cut(s) 83, 107, 119, 180
BfaI CTAG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 154
BmtI GCTAGC 1 cut(s) 21
BoxI GACNNNNGTC 1 cut(s) 99
BpmI CTGGAG 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 224
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 153
BseBI CCWGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 153
BseRI GAGGAG 3 cut(s) 107, 114, 134
BseSI GKGCMC 1 cut(s) 258
BsiSI CCGG 1 cut(s) 61
BsmAI GTCTC 4 cut(s) 83, 107, 119, 180
Bso31I GGTCTC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 258
BspACI CCGC 2 cut(s) 214, 239
BspOI GCTAGC 1 cut(s) 21
BspTNI GGTCTC 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 132
BstC8I GCNNGC 2 cut(s) 19, 243
BstEII GGTNACC 1 cut(s) 43
BstMAI GTCTC 4 cut(s) 83, 107, 119, 180
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 154
BstPAI GACNNNNGTC 1 cut(s) 99
BstPI GGTNACC 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 152
BstSLI GKGCMC 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 19, 243
Cfr13I GGNCC 1 cut(s) 236
CviJI RGCY 6 cut(s) 17, 172, 188, 196, 208, 288
CviKI_1 RGCY 6 cut(s) 17, 172, 188, 196, 208, 288
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
EciI GGCGGA 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 236
Eco91I GGTNACC 1 cut(s) 43
EcoO65I GGTNACC 1 cut(s) 43
EcoRII CCWGG 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 226
FaiI YATR 3 cut(s) 66, 192, 222
FspBI CTAG 1 cut(s) 18
GsuI CTGGAG 1 cut(s) 231
HapII CCGG 1 cut(s) 61
HindIII AAGCTT 1 cut(s) 186
HinfI GANTC 1 cut(s) 160
HpaII CCGG 1 cut(s) 61
HphI GGTGA 2 cut(s) 55, 169
Hpy188III TCNNGA 4 cut(s) 82, 92, 203, 248
HpyCH4V TGCA 1 cut(s) 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 8 cut(s) 67, 74, 96, 139, 166, 195, 255, 261
MaeI CTAG 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 43
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 258
MluCI AATT 1 cut(s) 86
MnlI CCTC 5 cut(s) 128, 135, 146, 155, 174
Mph1103I ATGCAT 1 cut(s) 226
MspI CCGG 1 cut(s) 61
MspR9I CCNGG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 154
MwoI GCNNNNNNNGC 1 cut(s) 18
NheI GCTAGC 1 cut(s) 17
NmuCI GTSAC 1 cut(s) 43
NsiI ATGCAT 1 cut(s) 226
PfeI GAWTC 1 cut(s) 160
PshAI GACNNNNGTC 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 152
PspEI GGTNACC 1 cut(s) 43
PspGI CCWGG 1 cut(s) 152
PspPI GGNCC 1 cut(s) 236
Sau96I GGNCC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 154
SduI GDGCHC 1 cut(s) 258
SetI ASST 3 cut(s) 76, 190, 210
SinI GGWCC 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 1 cut(s) 86
SsiI CCGC 2 cut(s) 214, 239
SspMI CTAG 1 cut(s) 18
StyD4I CCNGG 1 cut(s) 152
TaqI TCGA 1 cut(s) 93
TasI AATT 1 cut(s) 86
TfiI GAWTC 1 cut(s) 160
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 219
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 86
XspI CTAG 1 cut(s) 18
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.