RchiOBHm_Chr2g0132331

NEP1-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
48791273 .. 48792398
1126 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGGTCTCTCTGTTTGTCTCATTTTGCTTTTTTGGGAAGCACTTATTCTCCTGGTTTTTTTTGTCTTTCTTGGCTTATGCGTTAATGGATATTGATGTCATTGCGAGTCTCCTAAGTGGTAGATTAGTACGCGAGCGAATTGGTCCAGCCATGTTTGAGTGCAGTGCAAAGTCAGGCTATTGA

Protein Analysis

60

Amino Acids

6.82

Weight (kDa)

7.81

Isoelectric Point (pI)

21.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 132
AfaI GTAC 1 cut(s) 129
AjnI CCWGG 1 cut(s) 50
Alw26I GTCTC 3 cut(s) 10, 22, 113
AspS9I GGNCC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 52
BcoDI GTCTC 3 cut(s) 10, 22, 113
Bme1390I CCNGG 1 cut(s) 52
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 52
BsaI GGTCTC 1 cut(s) 10
BsaXI ACNNNNNCTCC 2 cut(s) 32, 62
Bse3DI GCAATG 1 cut(s) 99
BseBI CCWGG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 99
BsgI GTGCAG 1 cut(s) 181
Bsh1236I CGCG 1 cut(s) 132
BsmAI GTCTC 3 cut(s) 10, 22, 113
Bso31I GGTCTC 1 cut(s) 10
BspFNI CGCG 1 cut(s) 132
BspTNI GGTCTC 1 cut(s) 10
BsrDI GCAATG 1 cut(s) 99
Bst2UI CCWGG 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 113
BstFNI CGCG 1 cut(s) 132
BstMAI GTCTC 3 cut(s) 10, 22, 113
BstNI CCWGG 1 cut(s) 52
BstSCI CCNGG 1 cut(s) 50
BstUI CGCG 1 cut(s) 132
BtsI GCAGTG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 128
CviAII CATG 1 cut(s) 151
CviJI RGCY 3 cut(s) 74, 149, 177
CviKI_1 RGCY 3 cut(s) 74, 149, 177
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 1 cut(s) 113
Eco31I GGTCTC 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 50
FaeI CATG 1 cut(s) 154
FaiI YATR 2 cut(s) 78, 152
FatI CATG 1 cut(s) 150
Hin1II CATG 1 cut(s) 154
HinfI GANTC 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 162, 167
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 154
LpnPI CCDG 4 cut(s) 37, 64, 159, 159
MluCI AATT 1 cut(s) 138
MlyI GAGTC 1 cut(s) 115
MseI TTAA 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 52
MvaI CCWGG 1 cut(s) 52
MvnI CGCG 1 cut(s) 132
NlaIII CATG 1 cut(s) 154
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 50
PspGI CCWGG 1 cut(s) 50
PspPI GGNCC 1 cut(s) 143
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 143
SchI GAGTC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 52
SgeI CNNG 8 cut(s) 63, 64, 82, 117, 143, 145, 158, 163
SinI GGWCC 1 cut(s) 143
Sse9I AATT 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 50
TasI AATT 1 cut(s) 138
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TscAI CASTG 1 cut(s) 169
TspRI CASTG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.